Labshake search
Citations for Addgene :
1201 - 1250 of 2428 citations for 7 Benzyloxy 10 11 dihydrodibenzo b f 1 4 thiazepin 11 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and peroximal targeting signal 1 (Addgene, 54520) were cloned into mCherry-bearing pcDNA6 (Golgi-mCherry and PEX-mCherry) ...
-
bioRxiv - Neuroscience 2024Quote: ... or pLKO.1-TRC-control (Addgene_#10879) (Moffat et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... HIV-1 Rev (pRSV-Rev Addgene: 12253), and VSV g-glycoprotein Env (pMD2.G Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of pMD2.G (AddGene, #12259), and 1.5 μg of psPAX2 (AddGene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of pMD2.G (AddGene, #12259), and 1.5 μg of psPAX2 (AddGene ...
-
bioRxiv - Genomics 2021Quote: ... Cells were transfected for five hours with 60 μl of Lipofectamine 2000 and 10 μg of each of the plasmids pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) and pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Immunology 2022Quote: Lentiviral particles to generate CRISPR/Cas9-edited cell lines were produced by transfecting 10 cm dishes of HEK293T cells with 1.5 μg of pLentiCRISPRv2 encoding gene specific guide RNAs (Addgene plasmid #52961), 1 μg of p8.91 packaging plasmid(Zufferey et al. ...
-
bioRxiv - Genetics 2021Quote: ... Putative enhancers were attached to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from POPTOP plasmid (71) (Addgene #34848) by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Bioengineering 2020Quote: ... vectors were generated similarly to part vectors in 10 μL reactions with 20 fmol MTK landing pad entry backbone (Addgene #123932), 40 fmol of each expression vector plasmids ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus expressing the full length Phf15 cDNA or empty vector control were co-transfected with pCL-10 A1 (Addgene plasmid #15805)[30] in HEK293T cells using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... lentiparticles to generate CRISPR/Cas9-edited cell lines were produced by transfecting 10 cm dishes of HEK293T cells with 1.5 µg of plentiCRISPRv2 encoding gene specific guide RNAs (Addgene plasmid #52961), 1 µg of p8.91 packaging plasmid (Zufferey ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA encoding peptides derived from the C-terminal last 10 residues of the norovirus and cellular proteins were cloned into the pET-His-GST vector (Addgene:29655) with an N-terminal GST tag ...
-
bioRxiv - Genetics 2022Quote: ... Enhancer reporters were produced by fusing via PCR stitching these constructs to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from the POPTOP plasmid [53] (Addgene #34848). The enhancer reporters were purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... the following packaging and envelop plasmids were added to all of the 10-cm dishes as well: psPAX2 (6 μg) and pMD2.G (0.75 μg, Addgene, catalog #: 12259). psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Neuroscience 2020Quote: ... while eight animals received injections of a non-DREADD expressing viral control AAV5-CaMKIIa-EGFP (titer 4.3×10^12 GC/ml; Addgene, MA, USA), All animals received three viral injections in the anterior cingulate cortex in each hemisphere as follows (skull at +5.0mm to horizontal plane) ...
-
bioRxiv - Neuroscience 2020Quote: ... the experimental group (n = 12) received injections of AAV5-CaMKIIa-hM4Di-mCherry (titer 4.4×10^12 GC/ml; Addgene, MA, USA;) and the control group (n = 10 ...
-
bioRxiv - Cell Biology 2020Quote: ... were maintained in DMEM supplemented with 10% FBS and 1x penicillin/streptomycin and were used to produce lentiviral particles with psPAX2 (Addgene 12260), pMD2.G (Addgene 12259 ...
-
bioRxiv - Pathology 2021Quote: ... HEK293T cell (2.5 × 106) were seeded in a 100 mm-dish and co-transfected by calcium phosphate with 10 μg pLVTHM/GFP (Addgene 12247), 7.5 μg psPAX2 (Addgene 12260) ...
-
bioRxiv - Neuroscience 2022Quote: ... Experiments with inducible Cre used 2-20 fmol (10-100 ng) pCAG ERT2-Cre-ERT2 (Addgene #3777, Matsuda and Cepko, 2007) per coverslip ...
-
bioRxiv - Developmental Biology 2021Quote: ... The sgRNA targeting the dpy-10 locus (Arribere et al., 2014) was cloned into the pU6::sgR-NA expression vector pJJR50 (Addgene #75026) as previously described (Waaijers et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... The cells were transfected with 5 μg (in 10-cm dish) or 12.5 μg (in 15-cm dish) of pCMV-VSV-G expression plasmid (Addgene, Plasmid #8454) using Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2024Quote: ... and ligated into the pre-digested promoter-less plasmid to generate the pAAVS1-P-CAG-mNG21-10 repair template (Addgene #206042). For BclI digestion ...
-
bioRxiv - Neuroscience 2023Quote: ... 2014) AAV2-hSyn-DIO-hM4D(Gi)- mCherry vector (titer ≥ 5×10¹² vg/mL) was attained from AddGene (catalog number 44362-AAV2). Rats were anesthetized with 2.5% isoflurane ...
-
bioRxiv - Cell Biology 2023Quote: ... were maintained in DMEM supplemented with 10% FBS and 1x penicillin/streptomycin were used to produce lentiviral particles with psPAX2 (Addgene 12260), pMD2.G (Addgene 12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... Scarlet-tagged constructs were created by Gibson assembly of inserts generated by PCR from βII-spectrin SR1-17:mGreenLantern and αII-spectrin SR8-10:mGreenLantern inserted into pCCL-mScarlet (Addgene, #209889).
-
bioRxiv - Neuroscience 2024Quote: ... Ai32 mice expressing Cre-dependent ChR2-eYFP were injected with AAV1.CamKII0.4.Cre.SV40 (Addgene, #105558-AAV1, titer: 3.5×10¹² vg/mL) in three different locations along RL and two different depths (250 µm and 500 µm ...
-
bioRxiv - Cancer Biology 2024Quote: 293T cells (1.5 x 106 cells in a 10-cm dish) were transfected with the pCDH-puro-CMV-VC3AI lentiviral vector (Addgene, 78907) using Lipofectamine 2000 ...
-
bioRxiv - Neuroscience 2019Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl−1) and either p3xP3-EGFP.vas-int.NLS (400 ng µl−1) (Addgene #60948)69 or pBS130 (encoding phiC31 integrase under control of a heat shock promoter ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV rtTA3 Blast (w756-1) and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 knockdown mediated by shRNA was performed using pLKO.1-blast plasmid (modified from pLKO.1-puro, #10878, Addgene) with following shRNAs ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Developmental Biology 2023Quote: ... animals were injected with a target transgene (50 ng μl-1) with plasmid pJL43.1 (50 ng μl-1) (Addgene) that expresses MosTase under a germline promoter and plasmid pMR910 (20 ng μl-1 ...
-
bioRxiv - Microbiology 2023Quote: ... pLentiCMVPuroDEST (w118-1) and pLentiCMVHygroDEST (w117-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17452 and #17454) [33] ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Neuroscience 2023Quote: ... or a 1:1 combination of GCaMP6f+hM4Di-mCherry (same as used for behavior, AAV8-CaMKIIa-hM4Di-mCherry, Addgene).
-
bioRxiv - Genomics 2024Quote: ... the 1 μg of total DNA was split in a 1:15 ratio of pCAG-NLS-Bxb1 (Addgene #51271) and recombination vector ...
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLenti CMV rtTA3 Hygro (w785-1) used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434 ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For loss of function studies, pLKO.1 puro and pLKO.1 shCDH1 (Onder et al., 2008) were purchased from Addgene. pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120 ...
-
bioRxiv - Cell Biology 2022Quote: ... gBlock 1 encoding N-terminus Calponin domains (CH-CH) of giant Nesprin 1 was cloned into Spectrin-cpstFRET (plasmid#61109, Addgene) cut with AgeI and ScaI renstriction enzymes (New England Biosciences) ...
-
bioRxiv - Cell Biology 2019Quote: ... The short isoform of human NEAT-1 lncRNA (hNEAT-1 v1) was amplified from the plasmid pCRII_TOPO_hNEAT1 (a gift from Archa Fox, Addgene plasmid 61518) and incorporated into an AgeI/BamHI digested pmax-ponA backbone vector ...
-
bioRxiv - Microbiology 2020Quote: ... pmTurquiose2-Golgi (Beta-1,4-galactosyltransferase 1 1-61 Aa) in red is to show the Golgi apparatus (Addgene cat 36205) (27) ...
-
bioRxiv - Physiology 2019Quote: ... annealed and cloned into pLKO.1 at EcoRI and AgeI restriction sites as per the pLKO.1 protocol from Addgene. The resultant plasmids were transformed in DH5α cells for amplification and isolated ...
-
bioRxiv - Immunology 2020Quote: ... and the full-length protein (IFT20, aa 1-132) in-frame with the tags into the pEGFP-N1 (#6085-1 Addgene) and pGEX-6P-2 vectors (#27-4598-01Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Biochemistry 2024Quote: ... The Venus-PDZ1 (ZO-1) was generated by site directed mutagenesis of the Venus-ZO-1 expression vector (Addgene: 56394) using primer pairs that delete the entire ZO-1 coding sequence except for the first PDZ1 domain ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...