Labshake search
Citations for Addgene :
1151 - 1200 of 2293 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... LV-Cre pLKO.1 (Addgene plasmid 25997), which encodes Cre-recombinase in the backbone of the pLKO.1 vector ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... 1/10th mass BirA (Addgene plasmid 20857), and 50 µM D-biotin at 30 °C for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... and empty pKLO.1-hygro (Addgene, 24150) were used as negative controls.
-
bioRxiv - Cancer Biology 2023Quote: ... pMD2.G (1 µg; Addgene, Cat# 12259) and psPAX2 (2 µg ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μg packaging plasmid (Addgene #12260). 24 hours post transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-shGFP control (Addgene, cat#30323); pLKO.1-shATR (TCRN0000039615 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and inserted into pLKO.1 Vector (Addgene). To package the third generation lentiviral vectors ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD2.G (1 µg, Addgene, 12259), plus the pscALPS-hACE2 or -cACE2 (1 µg ...
-
bioRxiv - Immunology 2023Quote: ... pLenti CMV rtTA3 Blast (Addgene w756-1) stably expressing clonal RAW MΦs were transduced with pLenti CMV Puro DEST (Addgene w118-1 ...
-
bioRxiv - Immunology 2024Quote: ... psPAX2 (1 µg; Addgene plasmid no. 12260) and pTRIP-SFFV-CD271-P2A-ACE2 (1.6 µg ...
-
bioRxiv - Cell Biology 2023Quote: ... and cloned into pLKO.1 (Addgene #10878). The VSV-G envelope expressing plasmid pMD2.G ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μg psPAX2 (Addgene plasmid #12260) in 50 μL Opt-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... DR8.2 (1 µg) packaging construct (Addgene #8455) and the PMD2.G (5 μg ...
-
bioRxiv - Neuroscience 2019Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl−1) and either p3xP3-EGFP.vas-int.NLS (400 ng µl−1) (Addgene #60948)69 or pBS130 (encoding phiC31 integrase under control of a heat shock promoter ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV rtTA3 Blast (w756-1) and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 knockdown mediated by shRNA was performed using pLKO.1-blast plasmid (modified from pLKO.1-puro, #10878, Addgene) with following shRNAs ...
-
bioRxiv - Microbiology 2023Quote: ... pLentiCMVPuroDEST (w118-1) and pLentiCMVHygroDEST (w117-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17452 and #17454) [33] ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Neuroscience 2023Quote: ... or a 1:1 combination of GCaMP6f+hM4Di-mCherry (same as used for behavior, AAV8-CaMKIIa-hM4Di-mCherry, Addgene).
-
bioRxiv - Genomics 2024Quote: ... the 1 μg of total DNA was split in a 1:15 ratio of pCAG-NLS-Bxb1 (Addgene #51271) and recombination vector ...
-
bioRxiv - Developmental Biology 2023Quote: ... animals were injected with a target transgene (50 ng μl-1) with plasmid pJL43.1 (50 ng μl-1) (Addgene) that expresses MosTase under a germline promoter and plasmid pMR910 (20 ng μl-1 ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Genomics 2021Quote: ... Cells were transfected for five hours with 60 μl of Lipofectamine 2000 and 10 μg of each of the plasmids pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) and pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Immunology 2022Quote: Lentiviral particles to generate CRISPR/Cas9-edited cell lines were produced by transfecting 10 cm dishes of HEK293T cells with 1.5 μg of pLentiCRISPRv2 encoding gene specific guide RNAs (Addgene plasmid #52961), 1 μg of p8.91 packaging plasmid(Zufferey et al. ...
-
bioRxiv - Bioengineering 2020Quote: ... vectors were generated similarly to part vectors in 10 μL reactions with 20 fmol MTK landing pad entry backbone (Addgene #123932), 40 fmol of each expression vector plasmids ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus expressing the full length Phf15 cDNA or empty vector control were co-transfected with pCL-10 A1 (Addgene plasmid #15805)[30] in HEK293T cells using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... lentiparticles to generate CRISPR/Cas9-edited cell lines were produced by transfecting 10 cm dishes of HEK293T cells with 1.5 µg of plentiCRISPRv2 encoding gene specific guide RNAs (Addgene plasmid #52961), 1 µg of p8.91 packaging plasmid (Zufferey ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA encoding peptides derived from the C-terminal last 10 residues of the norovirus and cellular proteins were cloned into the pET-His-GST vector (Addgene:29655) with an N-terminal GST tag ...
-
bioRxiv - Cell Biology 2022Quote: ... the following packaging and envelop plasmids were added to all of the 10-cm dishes as well: psPAX2 (6 μg) and pMD2.G (0.75 μg, Addgene, catalog #: 12259). psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Neuroscience 2020Quote: ... while eight animals received injections of a non-DREADD expressing viral control AAV5-CaMKIIa-EGFP (titer 4.3×10^12 GC/ml; Addgene, MA, USA), All animals received three viral injections in the anterior cingulate cortex in each hemisphere as follows (skull at +5.0mm to horizontal plane) ...
-
bioRxiv - Neuroscience 2020Quote: ... the experimental group (n = 12) received injections of AAV5-CaMKIIa-hM4Di-mCherry (titer 4.4×10^12 GC/ml; Addgene, MA, USA;) and the control group (n = 10 ...
-
bioRxiv - Immunology 2021Quote: ... Platinum-E cells were transfected at 70-80% confluency on 10 cm plates with 4 μg pCL-Eco(40) and 6 μg of either pMSCV-pBabeMCS-IRES-RFP (Addgene; 33337) or pMSCV-Myc-IRES-RFP (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... were maintained in DMEM supplemented with 10% FBS and 1x penicillin/streptomycin and were used to produce lentiviral particles with psPAX2 (Addgene 12260), pMD2.G (Addgene 12259 ...
-
bioRxiv - Pathology 2021Quote: ... HEK293T cell (2.5 × 106) were seeded in a 100 mm-dish and co-transfected by calcium phosphate with 10 μg pLVTHM/GFP (Addgene 12247), 7.5 μg psPAX2 (Addgene 12260) ...
-
bioRxiv - Neuroscience 2022Quote: ... Experiments with inducible Cre used 2-20 fmol (10-100 ng) pCAG ERT2-Cre-ERT2 (Addgene #3777, Matsuda and Cepko, 2007) per coverslip ...
-
bioRxiv - Developmental Biology 2021Quote: ... The sgRNA targeting the dpy-10 locus (Arribere et al., 2014) was cloned into the pU6::sgR-NA expression vector pJJR50 (Addgene #75026) as previously described (Waaijers et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... The cells were transfected with 5 μg (in 10-cm dish) or 12.5 μg (in 15-cm dish) of pCMV-VSV-G expression plasmid (Addgene, Plasmid #8454) using Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2014) AAV2-hSyn-DIO-hM4D(Gi)- mCherry vector (titer ≥ 5×10¹² vg/mL) was attained from AddGene (catalog number 44362-AAV2). Rats were anesthetized with 2.5% isoflurane ...
-
bioRxiv - Cell Biology 2023Quote: ... were maintained in DMEM supplemented with 10% FBS and 1x penicillin/streptomycin were used to produce lentiviral particles with psPAX2 (Addgene 12260), pMD2.G (Addgene 12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... and ligated into the pre-digested promoter-less plasmid to generate the pAAVS1-P-CAG-mNG21-10 repair template (Addgene #206042). For BclI digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLenti CMV rtTA3 Hygro (w785-1) used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434 ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For loss of function studies, pLKO.1 puro and pLKO.1 shCDH1 (Onder et al., 2008) were purchased from Addgene. pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120 ...
-
bioRxiv - Cell Biology 2022Quote: ... gBlock 1 encoding N-terminus Calponin domains (CH-CH) of giant Nesprin 1 was cloned into Spectrin-cpstFRET (plasmid#61109, Addgene) cut with AgeI and ScaI renstriction enzymes (New England Biosciences) ...