Labshake search
Citations for Addgene :
1101 - 1150 of 1655 citations for Rat Interleukin 1 Receptor Antagonist IL1RN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Independent representations of reward-predicting cues and reward history in frontal cortical neuronsbioRxiv - Neuroscience 2020Quote: ... The AAV solution (AAV1-hSyn-NES-jRGECO1a, titer ~1 × 1013 GC/ml, the viral solution provided by Addgene, viral prep # 100854-AAV1 ...
-
bioRxiv - Genomics 2021Quote: ... The Dlx promoter sequence was from pAAV-mDlx-GFP-Fishell-1 (Addgene plasmid #83900; http://n2t.net/addgene:83900; RRID:Addgene_83900)(Dimidschstein et al. ...
-
bioRxiv - Cell Biology 2021Quote: Gibson Assembly (Gibson et al., 2009) was performed with three DNA fragments: (1) linearized pPtPBR1 episome backbone (Addgene, Cambridge ...
-
bioRxiv - Plant Biology 2021Quote: ... pENTR4-GFP-C3 (w393-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17397; http://n2t.net/addgene:17397; RRID:Addgene_17397). The pENTR4 plasmids were recombined in Gateway LR reactions with pGWB414 (Nakagawa et al. ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963) ...
-
bioRxiv - Developmental Biology 2021Quote: The following constructs were procured for the study: pGEX4T-1 (gift from Fernando Martin- Belmonte; Addgene plasmid #40059); pmCherry-C1 hSlp2-a (gift from Fernando Martin- Belmonte ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 1 ug total DNA (0.5 ug PCR product and 0.5 ug AsCpf1_TATV Cas12 [Addgene: 89354]) using Xtreme-GENE 9 following manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (Addgene, #16399). Successful incorporation of pShuttle-CMV construct into AdEasier-1 cells confirmed via digestion with PacI (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... dlg-1::mCherry and ebp-2::egfp vectors were cloned using Gibson assembly and vector pJJR82 (Addgene #75027) (Gibson et al. ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Biophysics 2022Quote: A plasmid encoding ACE2 residues 1-615 (pcDNA3-sACE2(WT)-8his) was a gift from Erik Procko (Addgene plasmid # 149268 ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA sequences containing the following target sequences were cloned into the pLKO.1-TRC cloning vector (Addgene, 10878): nontargeting (NT) ...
-
bioRxiv - Cell Biology 2022Quote: ... These oligos were annealed in annealing buffer (10 mM Tris pH 7.5-8.0, 50 mM NaCl, 1 mM EDTA) as recommended by Addgene (https://www.addgene.org/protocols/annealed-oligo-cloning) ...
-
bioRxiv - Genetics 2022Quote: ... The PCR product was cloned via Gibson assembly into AgeI and EcoRI digested pLKO.1 vector (Addgene#8453). Ligated libraries were electroporated into DH5a electrocompetent cells (Invitrogen) ...
-
bioRxiv - Systems Biology 2022Quote: ... The mKO2 insert was derived from pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120) (Addgene, #83841). Lentiviral Parkin expression vector (pLv-CMV-Parkin-A92mKO2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... MEFs cells were infected with a pLKO.1-Puro plasmid encoding a scrambled shRNA sequence (Addgene plasmid #1864). A list of the shRNA sequences is provided in Supplementary Table 2.
-
bioRxiv - Plant Biology 2023Quote: ... The resulting amplicons were assembled in Level 1 acceptors with an AtU626 promoter (pICSL90002, AtU6-26 Addgene#68261). The final construct was assembled by combining the two Level 1 sgRNA cassettes with cassettes for resistance to kanamycin pICSL11024 (Addgene#51144 ...
-
bioRxiv - Microbiology 2022Quote: ... shRNA sequence of p21 (shp21.1:TRCN0000287021, shp21.2:TRCN0000040126) were cloned into lentiviral vector pLKO.1 neo (Addgene#13425) or pLKO.1 mCherry-Puro generated by overlapping PCR using primer pairs (Table S1 ...
-
bioRxiv - Neuroscience 2022Quote: ... chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475; 4.8×1012 GC ml-1). Retrograde rabies tracing25 ...
-
bioRxiv - Neuroscience 2022Quote: ... <1 μL in total; 1013 vg/mL; pAAV/.Syn.NES-jRGECO1a.WPRESV40--AAV9, pGP-AAV-syn-jGCaMP7s-WPRE AAV9, Addgene) were administered into the hemisphere contralateral to the prism implant (+0.75 – 1.25 mm AP ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900; http://n2t.net/addgene:83900; RRID:Addgene_83900) by restriction subcloning ...
-
bioRxiv - Cancer Biology 2024Quote: ... (shp53 pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 19119 ; http://n2t.net/addgene:19119 ; RRID:Addgene_19119)) [46].
-
bioRxiv - Microbiology 2024Quote: ... N/Tert-1 Cas9 knockout cells were generated by transduction with a spCas9 lentiviral expression vector (Addgene # 52962) and selecting with blasticidin ...
-
bioRxiv - Cancer Biology 2024Quote: ... WT and mutant constructs were subsequently cloned into the vector pLenti CMV Neo DEST (705-1) (Addgene, #17392) by the GATEWAY cloning system ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/1 (a gift from James M. Wilson, Addgene plasmid #112862; http://n2t.net/addgene:112862; RRID: Addgene_112862) were used for virus production ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Microbiology 2024Quote: ... were cloned into CMV Blast DEST (706–1) (a gift from Eric Campeau & Paul Kaufman, Addgene plasmid #17451) expression vector resulting in plasmid AX581 ...
-
bioRxiv - Cancer Biology 2024Quote: ... subcloning and sequencing The pLJM1-empty (#91980) and PD-1-miSFIT-1x (#124679) vectors were purchased from Addgene. PTEN and PD-1 were subcloned into linearized pLJM1-empty vector using EcoR1 and NHE1 restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2024Quote: The pLKO.1 – TRC cloning vector was a gift from David Root (Addgene plasmid # 10878; http://n2t.net/addgene:10878 ; RRID:Addgene_10878). The shRNA sequences were cloned into the AgeI and EcoRI sites of the plasmid using standard cloning techniques ...
-
bioRxiv - Neuroscience 2023Quote: ... or an empty vector (control, AAV5-Ef1a-DIO EYFP at titer ≥ 1×10¹³ vg/mL, Addgene plasmid # 27056) were utilized ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM TCEP) and digested with SUMO protease overnight (expressed and purified in-house from Addgene plasmid pCDB30243). The cleaved protein was dialyzed against Buffer D (25 mM HEPES ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488 ...
-
bioRxiv - Cell Biology 2023Quote: ... The pEGFP-N1- hDEK plasmid (DEK WT sequence inserted into eGFP reporter plasmid “peGFP-N1”; Addgene 6085-1) was used as a template for mutagenesis PCR ...
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng of pcDNA3.3-hCas9 plasmid (constructed by inserting the Cas9 fragment released from Addgene #41815 (ref. 119), into the pcDNA3.3 vector ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371; http://n2t.net/addgene:185371; RRID:Addgene_185371), MEK1-GFP was a gift from Rony Seger (Addgene plasmid # 14746 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... we additionally injected an AAV encoding for jRGECO1a (AAV2/1-Syn-NES-jRGECO1a-WPRE-SV40, Addgene 100854-AAV1) in 3 locations in V1 (roughly the vertices of a 550 μm-wide equilateral triangle centered 3.5 mm posterior and 2.6 mm lateral to Bregma ...
-
bioRxiv - Cell Biology 2023Quote: ... were created via PCR amplification (see primer list) and assembled into a Spe-1 digested pCFJ151 (Addgene #19330) vector using isothermal assembly (Gibson et al. ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... flanked by 1-kb Nelfe HDR sequences: The insert was obtained from pCRIS-PITCHv2-dTAG-Puro (Addgene 91796) (Nabet et al ...
-
bioRxiv - Genomics 2022Quote: ... The open reading frames of H3 and H4 were cloned in the Dox-inducible expression vector KA0717 (KA0717_pPB-hCMV*1-cHA-IRESVenus was a gift from Hans Schöler, Addgene plasmid #124168 ...
-
bioRxiv - Developmental Biology 2023Quote: ... nls::Cas9::nls (subcloned from Eef1a-1955/- 1>nls::Cas9::nls a gift from Lionel Christiaen, Addgene plasmid # 59987 ;http://n2t.net/addgene:59987 ; RRID:Addgene_59987)52 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... coding for the large T oncogene SV40 (V40 1: pBSSVD2005 was a gift from David Ron; Addgene plasmid #21826; http://n2t.net/addgene:21826; RRID:Addgene_21826), using LipofectamineTM LTX (Invitrogen #L3000-008 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (MSCV-IRES-Thy1.1 DEST was provided to Addgene by Dr. Anjana Rao, Addgene plasmid# 17442 ; http://n2t.net/addgene:17442 ; RRID:Addgene_17442) using TaKaRa In-Fusion HD Cloning Plus kits (Cat# 638917 ...
-
bioRxiv - Neuroscience 2023Quote: ... The annealed oligos were then ligated into U6 promotor-based cassettes: ipo13b sgRNA1 into pU6a:sgRNA#1 (Addgene #64245), ipo13b sgRNA2 into pU6a:sgRNA#2 (Addgene #64246) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-HA-Ubiquitin (Ub) was a gift from Edward Yeh (Addgene plasmid #18712; http://n2t.net/addgene:18712; RRID:Addgene_18712). Full length tsa56 (OTT_0945 ...