Labshake search
Citations for Addgene :
1101 - 1150 of 3022 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the signal peptide (0-26 amino acids) of pro-opiomelanocortin (#176704, Addgene) and ectodomain (52-750 amino acids ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328 ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9; http://n2t.net/addgene:100833; RRID:Addgene_100833). pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR-amplified fragment of pie-1p::gfp::PH::pie-1 3’UTR was inserted into pCFJ1662 (a gift from Erik Jorgensen, Addgene #51482). Plasmid mixtures containing pCFJ1662_PH ...
-
bioRxiv - Cell Biology 2024Quote: Individual single-guide RNAs (sgRNAs) (sgBTN3A2 #1: TGTTCTCTCCCTTGGCGTTGCTCCACTGTA; sgBTN3A2 #3: ATCATGAGAGGCGGCTCCGGGGAGGGTGTATC) targeting the candidate gene were cloned into linearized lentiCRISPRv2 (#52961, Addgene, USA). Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2020Quote: [4] QF2w-Hsp70frompQF2wWB(Addgene plasmid #61313) (Primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (4 µg, Addgene plasmid # 12260) and pAdVAntage (1.6 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μg of psPAX2 (Addgene #12260) and 8 μg of purified pLKO.1 plasmid containing the shRNA constructs upon reaching 70% confluency ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Microbiology 2023Quote: ... Truncation mutations in NL4-3 were created by subcloning the region of NL4-3 between EcoRI to XhoI into pBlueScript KS(-) (Addgene), followed by site-directed mutagenesis to introduce a stop codon to generate the desired truncation mutation ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA targeting Pml exon 1 (Table 4) was subcloned into the pSpCas9 (BB)-2A-Puro plasmid (pX459v2, Addgene) and transfection of mESCs was performed using lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-Flpo-3×FLAG (no. 173047, Addgene), which has the hSyn promoter followed by Flpo with 3×FLAG C-terminal tag (OGS629 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5ng of a reference plasmid (pNL4-3, Addgene) was spiked in to each DNA preparation and used for qPCR normalization (Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 50 ng/µl Peft-3::Cas9 (Addgene 46168) and 2,5 ng/µl Pmyo-2::tdTomato ...
-
bioRxiv - Immunology 2021Quote: ... 3 μg of pIRES-eGFP plasmid DNA (Addgene) were digested with 250 U of Benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3 µg VSVG packaging vector (Addgene, 8454) in a 100 mm dish using a calcium phosphate transfection kit (CalPhos Mammalian Transfection kit ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 μg pCMV-VSV.G (Addgene, Watertown, MA; #8454), and 4 μg CD19-CAR-GFP transfer plasmid (Bloemberg et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-Flpo (Addgene #125576, 3-10 ng/μL) and pCAFNF-tdTomato (Addgene#125575 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 with primers 1010.C5 and 1010.C6 ...
-
bioRxiv - Bioengineering 2020Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 19 with primers 986.C3 and 986.C4 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746 ...
-
bioRxiv - Neuroscience 2023Quote: ... and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247). Ligation reactions were carried out by mixing 1 µL 10x NEB CutSmart buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... pGEX-4T-3-mR7BD (Addgene #79149, Edinger Lab). To generate Emerald-Rab7L8A ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3) AAV9-hSyn-ChR2(H134R)-eYFP (RRID:Addgene_127090 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pN3-3×Flag-Control was purchased from Addgene (Watertown ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 3 μg of pCXWB-EBNA1 (Addgene #37624) were co-nucleofected into 1×106 primed hiPSCs using the Lonza 4D-nucleofector (“Primary Cell P3” solution ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-CD19 and anti-Spike scFv amino acid sequences were obtained from Addgene plasmids #79125 and #155364 ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-CD19 and anti-HER2 scFv amino acid sequences were obtained from Addgene plasmids #79125 and #85424 ...
-
bioRxiv - Immunology 2022Quote: ... Anti-CD19 and anti-Her2 scFv amino acid sequences were obtained from Addgene plasmids #79125 and #85424 ...
-
bioRxiv - Biochemistry 2023Quote: NSD2-PWWP1 (amino acids 211-350) was cloned into a pET28-MHL (RRID:Addgene_26096) vector with a N-terminal His-tag followed by a TEV-cleavage site ...
-
bioRxiv - Cell Biology 2019Quote: To generate clonal cell lines that are deficient for SURF4, a sgRNA targeting SURF4 exon 2 (SI Appendix, Table S1) was cloned into the PX459 plasmid (Addgene: 62988, a gift from Feng Zhang) as previously described (95) ...
-
bioRxiv - Cell Biology 2019Quote: ... BbsI digested fragment containing gRNA core and dU6:3 promoter was PCR amplified from pCFD4-U6:1_U6:3-tandemgRNAs (gift from Simon Bullock (Addgene plasmid # 49411) (Port et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... was generated via Gibson Assembly based on pmyo-3::QuasAr::mOrange and pPD96.52 (pmyo-3, Fire Lab Vector Kit, Addgene plasmid #1608), using restriction enzymes BamHI and XbaI and primers QUASAR_fwd (5’-cccacgaccactagatccatATGGTAAGTATCGCTCTGCAG-3’ ...
-
bioRxiv - Immunology 2024Quote: HEK293T cells were transfected with 3 µg of pmirGLO plasmid containing the 3’UTR of Zc3h12a or Tnf (Addgene plasmid 207127) (7 ...
-
bioRxiv - Developmental Biology 2021Quote: For mammalian 2-hybrid assays 2.15 x 105 HEK293 or 4 x 105 A375 cells were transiently transfected with 1 µg firefly luciferase reporter plasmid (5xGAL4-TATA-luciferase, Addgene, 46756) (Sun et al ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were reprogrammed by a mixture of retroviral vectors encoding OCT3/4 (pMXs-hOCT3/4 Addgene: 17217), SOX2 (pMXs-hSOX2 Addgene ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077 ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 μg psPAX2 packing plasmid (Addgene, 12260), and 0.8 μg pMD2.G envelope plasmid (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLS-hOCT3/4 (Addgene plasmid #27076) episomal vectors (Okita et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of psPAX2 (Addgene plasmid # 12260), and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg hCas9 D10A (Addgene plasmid #41816) (Mali et al. ...