Labshake search
Citations for Addgene :
1101 - 1150 of 2496 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... or 1 μl of AAV5-hSyn-DIO-mCherry (1012 particles.ml−1, Addgene, #50459-AAV5). The virus was infused at a rate of 0.2 μL.min−1 using microinjection cannula (33-gauge ...
-
bioRxiv - Molecular Biology 2020Quote: ... were diluted (1:100) and cloned into pLKO.1 TRC-Cloning vector (Addgene # 10878) that had been digested with EcoRI and AgeI ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μL of AAV9-hsyn-cre-2a-tdT (Addgene#107738, titer ∼1×10^13) was diluted with 3 μL of PBS and was injected into the subarachnoid space of one hemisphere at the level of somatosensory cortex in Mtor-floxed-5XFAD mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... ZIF-1 and GFP-nanobody::ZIF-1 sequences were amplified from pOD2046 (Addgene #89367) (Wang et al ...
-
bioRxiv - Neuroscience 2024Quote: ... mixed at a 1:1 ratio with AAV8-Ef1a-Con/Fon-mCherry (Addgene #137132) or pAAV8-hsyn-DIO-mCherry (Addgene #50459 ...
-
bioRxiv - Molecular Biology 2020Quote: ... residues 1-271 (Addgene #138421), and residues 1-133 (Addgene #138422 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PLKO.1 (Addgene, #10878 [34]), for expression of Cas12a gRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µg psPAX2 (Addgene, 12260), 2 µg lentiviral plasmids and 10 µl dH2O was further added with 150 µl serum free DMEM and 9 µl X-tremeGENE HP DNA Transfection Reagent (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-1 (Addgene, #170447), MERS-CoV (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.shNkx2-1 (Addgene Plasmid #32400) or pLKO.shScramble (Addgene Plasmid #1864 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 Lentiviral constructs (Addgene) were transfected into 293FT cells using 35μg polyethylenimine per transfection (Alfa Aesar) ...
-
bioRxiv - Cell Biology 2020Quote: pLKO.1 puro (Addgene #8453) was modified to carry:
-
bioRxiv - Cancer Biology 2023Quote: ... The pLKO.1 (Addgene #8453) lentiviral vector was digested with AgeI (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1.syn.jGCaMP7s 50 (Addgene, 104487-AAV1 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... pISH-Gucy2d-1 (Addgene, #105459), pISH-V1rb1 (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-neo (Addgene, 13425) was used as the backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-110 (Addgene #213500), α-syn 96-140 (Addgene #213501) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PLKO.1 (Plasmid #8453, Addgene) backbone was used ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-95 (Addgene #213499), α-syn 1-110 (Addgene #213500) ...
-
bioRxiv - Neuroscience 2022Quote: pLKO.1-TRC (Addgene, 10878) vector was used for the knockdown of YTHDF2 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-1:PXN-EGFP (Addgene plasmid #87420 ...
-
bioRxiv - Cell Biology 2022Quote: ... pMA122 (peel-1, Addgene #34873), and co-injection markers were injected into N2 young adult worms ...
-
bioRxiv - Cancer Biology 2024Quote: pLKO.1 puro (Addgene #8453), pMDLg/pRRE (Addgene #12251) ...
-
bioRxiv - Cell Biology 2024Quote: ... pLKO.1-Scrambled (Addgene #136035) 100 was modified to express H2B-mRuby3 for visual identification of transduced cells based on a nuclear fluorescence signal101 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLKO.1-TRCN0000020840 (shSTAT3, Addgene), pLKO-TRCN0000280021 (shSTAT1 ...
-
bioRxiv - Genetics 2020Quote: ... The C-terminal portion of the hygromycin resistance gene and the unc-54 3’ UTR were then independently amplified from pCFJ1663 (Addgene #514840 from the lab of Erik Jorgensen) and inserted into the SbfI site of pMS4 to create the final landing pad plasmids (pMS70-75) ...
-
bioRxiv - Developmental Biology 2020Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... 2012), and followed by an eGFP-containing 5’ UTR (pGH112, Erik Jorgensen) in the destination vector pCFJ150 (Erik Jorgensen, Addgene plasmid #19329). The GCaMP6f-containing plasmid (Prig-3::GCaMP6f::unc-54 ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Developmental Biology 2021Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1ug of either SF3B1 sgRNA or Rosa26 sgRNA in pLKO.5 Puro-2A-GFP backbone was co-transfected with either 1ug of NG-ABE8e (Addgene plasmid 13849) or NG-ABEmax (Addgene plasmid 124163) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Biophysics 2023Quote: ... followed by ligation in place of the mApple sequence in the mApple-CD36-C-10 vector (Addgene, Watertown, MA plasmid # 54874 (5)) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A previously published plasmid (Brunet et al., 2021) encoding the pEFL-pac-5’Act cassette was used as a template (Addgene ID NK802). Custom primers were designed to add an 18-nucleotide premature termination cassette (5’-TTTATTTAATTAAATAAA-3’ ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... donor vector (400 ng µl-1) and pHsp70-Cas9 (400 ng µl-1) (Addgene #45945) [69] ...
-
bioRxiv - Neuroscience 2020Quote: ... We then injected the AAV5.CamKII.GCaMP6f.WPRE.SV40 virus (Addgene # 100834; 200 nL at 1 nl.s-1) in hippocampal CA1 using the following coordinates ...
-
bioRxiv - Neuroscience 2022Quote: ... a 1:1 mixture (100 nl total) of either retrograde AAV-hSyn-DIO-eGFP (Addgene) and AAV2-hSyn-mCherry (UNC vector core ...
-
bioRxiv - Neuroscience 2024Quote: ... a 1:1 mixture of AAV8-hSyn-DIO-EGFP (2.3 x 1013 CG/mL, Addgene) and AAV8-Flex-3mts-mScarlet (1.14 x 1013 CG/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... cohort 1) or AAV9.EF1a.dflox.hChR2(H134R).mCherry.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2).
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected for lentiviral production in media containing 5 μg of each lentiviral packing plasmid (pMD2.G and psPAX2, Addgene: #12259, #12260, respectively), 10 μg of the scramble pLKO.1 or the NNT constructs (named here 1 and 2 ...
-
bioRxiv - Neuroscience 2021Quote: ... and four mice (control group) were stereotactically injected in the DR with AAV2/5-EF1α-DIO-WPRE-eYFP (Addgene viral prep 27056-AAV5) at a rate of 75 nl per min using surgical procedures (anesthesia ...
-
bioRxiv - Molecular Biology 2023Quote: The 5’ UTR of CCND2 mRNA was cloned into the pGL3-TK-5UTR-BsmBI-Luciferase reporter plasmid purchased from Addgene (https://www.addgene.org/114670/). The DNA fragment was amplified from cDNA prepared from HEK293T using primers with the extra 5’ end corresponding to the BsmbI cut sites in the plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... together with 10 µg psPAX2 lentivirus packaging plasmid and 5 µg lentivirus envelope plasmid (gifts from Didier Trono, Addgene #12260 and #12259, respectively) using 90 µL 1 mg/mL Polyethylenimine Hydrochloride (Polysciences ...
-
bioRxiv - Neuroscience 2024Quote: ... D) or AAV2/5-CAG-dLight1.1 (left hemisphere: one mouse, right hemisphere: four mice, 111067-AAV5, Addgene, Watertown, MA, USA, Fig. 1E, F) was injected into the dorsomedial striatum (DMS ...
-
bioRxiv - Neuroscience 2022Quote: ... then virus (AAV9-CaMKII-Cre, stock 2.1*1013 particles/nL, 1:1 dilution in PBS, Addgene) was pressure injected (NanoJect III ...
-
bioRxiv - Neuroscience 2021Quote: The lentiviral knockdown constructs were made using pLKO.1-Puro or pLKO.1-GFP plasmids (Addgene) (Zhuang et al ...
-
bioRxiv - Neuroscience 2024Quote: ... 3.26e14 GC-ml) diluted 1:1 with PBS or AAV5-CaMKII-GCaMP6f.WPRE.SV40 (Addgene, 2.3e13 GC-ml) diluted with PBS 1:2 into dorsal CA1 (−1.8 mm from Bregma ...
-
bioRxiv - Molecular Biology 2020Quote: ... and residues 1-133 (Addgene #138422) were PCR amplified from pcDNA4/TO-ORF24-3xFLAG (19 ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-puro plasmids (Addgene #8453) were cloned as previously described (78) ...