Labshake search
Citations for Addgene :
1101 - 1150 of 1330 citations for 5 NITRO BENZO B THIOPHENE 2 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloning to insert SOX9 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP plasmid (a gift from Janet Rossant, Addgene plasmid # 112851). AAVS1 repair template was created by Infusion cloning to swap the CAG promoter and Puromycin resistance cassette in plasmid AICSDP-42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2012), and followed by an eGFP-containing 5’ UTR (pGH112, Erik Jorgensen) in the destination vector pCFJ150 (Erik Jorgensen, Addgene plasmid #19329). The GCaMP6f-containing plasmid (Prig-3::GCaMP6f::unc-54 ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Neuroscience 2019Quote: ... AAVrg-CAG-GFP (titer: 5×1012 vg/mL, this construct was a gift from Edward Boyden to Addgene-viral prep # 37825-AAVrg) and AAVrg pmSyn1-EBFP-Cre (titer ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Developmental Biology 2021Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... 5’- CGCGTCGACATGGTGAGCAAGGGCGAGGA-3’ and mCh REV: 5’-ACGCGGATCCCTTGTACAGCTCGTCCATGC-3’ and ligating it into pENTR4 no ccDB (gift from E. Campeau, Addgene plasmid #17424) plasmid (Campeau ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesized IRIS guide RNA oligonucleotide (target sequence: 5’-CTGGGGCAAACACAAAAACCTGG-3’) was cloned into the BsmB1 sites of the lentiCRISPRv2 vector (a gift from Feng Zhang, Addgene plasmid #52961)50 following the protocol described by Sanjana et al.50 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-GCGCCTCCTGCGAAGCCATCAGG-3’ and 5’-CGTAGCGGGAAGGGTCAAGAGGG-3’) were similarly cloned into the lentiCRISPRv2-hygro vector (a gift from Brett Stringer, Addgene plasmid #98291)51.
-
bioRxiv - Biophysics 2023Quote: ... followed by ligation in place of the mApple sequence in the mApple-CD36-C-10 vector (Addgene, Watertown, MA plasmid # 54874 (5)) ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1ug of either SF3B1 sgRNA or Rosa26 sgRNA in pLKO.5 Puro-2A-GFP backbone was co-transfected with either 1ug of NG-ABE8e (Addgene plasmid 13849) or NG-ABEmax (Addgene plasmid 124163) ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 µg of pCAGGS-S (SARS-CoV-2)(Catalog No. NR-52310: BEI Resources) or VSV-G (a gift from Tannishtha Reya (Addgene plasmid # 14888 ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Cell Biology 2020Quote: Two previously described sgRNAs specific to the Kap1 gene10 (Supplementary Table 2) were incorporated into plentiGuide-puro vector (Addgene #52963). For production of lentiviral particles ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Microbiology 2021Quote: ... pEZY-FLAG-Nsp14 vector was constructed from pDONR223 SARS-CoV-2 Nsp14 vector to the pEZY-FLAG (Cat # 18700, Addgene) destined vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... and gGene-N2a and gGene-N2b for Nickase 2) cloned into tandem U6 cassettes in a version of pX330 plasmid (pX330-U6-Chimeric_BB-CBh-hSpCas9, Addgene #42230) mutated to express Cas9D10A-T2A-GFP (Nickase-1/2) ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Biophysics 2022Quote: Live cell Mpro proteolytic cleavage activity assays were performed by co-transfecting HEK 293T cells with either the pmNG-Mpro-Nter-auto-NLuc or the pmNG-Mpro-Nter-auto-L-NLuc Mpro sensor plasmid constructs along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vectors of the full-length SARS-CoV-2 spike and the human serine protease TMPRSS2 with a C-terminal C9-tag (TETSQVAPA) were acquired from AddGene (Summit Pharmaceutical International ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Genetics 2020Quote: Prime Editor 2 (PE2) plasmid coding for the SpCas9 gene fused with the MLV reverse transcriptase was obtained from Addgene Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Biochemistry 2021Quote: ... PINK1 and PARKIN (Supplemental Table 2) were designed using CRISPOR.org14 and inserted into LentiCRISPRv2 plasmid15,16 (a gift from Feng Zhang (Addgene plasmid # 52961), as done before7 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Expi293F cells were transfected with pcDNA3-SARS-CoV-2-S-RBD-sfGFP (a gift from Erik Procko, Addgene plasmid # 141184) using ExpiFectamine™ 293 Transfection Kit according to manufacturer’s directions (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: The human codon-optimized CAS9 with 2×35S CaMV promoter and Nos terminator was amplified from pAGM4723 plasmid (Addgene# 49772) using KpnI forward and PacI reverse primers (Supplemental Table 9) ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Biophysics 2022Quote: ... RRID:Addgene_141370)85or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2022Quote: ... We have also generated targeting fragments to insert arrays into MosTI sites that use hygromycin and Pmlc-2::gfp but have not tested these fragments (although we deposited the reagents with Addgene). The protocols are identical except for using targeting fragments and sgRNAs that are specific to each insertion site (listed in Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: Chemical-genetic screens were initiated by thawing 2 × 1ml aliquots (1.0 OD600 units/mL) of the Mtb CRISPRi library (RLC12; Addgene 163954) and inoculating each aliquot into 19ml 7H9 supplemented with kanamycin (10 μg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Neuroscience 2019Quote: ... 2011) for electron microscopy experiments and AAV1/2.Syn-hChR2(H134R)-EYFP (Received as a gift from Karl Deisseroth, Addgene plasmid # 26973 ...
-
bioRxiv - Microbiology 2021Quote: ... A plasmid encoding stabilized SARS-CoV-2 spike protein S-HexaPro (Hsieh et al., 2020) was a gift from Jason McLellan (Addgene plasmid #154754 ...
-
bioRxiv - Biochemistry 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was previously described (Hsieh et al. 2020) and was a gift from Jason McLellan (Addgene plasmid #154754 ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-N-BE(2)-C cells were transduced with lentiviral constructs for stable expression of the different tested RRM2 promotor targeting sgRNAs (Addgene) (MP-I-1142 sg86RRM2 ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Microbiology 2022Quote: ... and pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro (a kind gift from Neven Krogan, available from Addgene #141391) with PEI ...