Labshake search
Citations for Addgene :
1001 - 1050 of 1353 citations for Recombinant Human IL21 Protein Fc Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Full-length human APLP1 gene with a Flag tag in the N-terminal was cloned from pCAX APLP1 (Addgene plasmid#30141) and the primers were shown in Key Resources Table (NheI-Flg-hAPLP1-F/XhoI-His-hAPLP1-R) ...
-
bioRxiv - Cancer Biology 2021Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag FKHR AAA mutant; gift from Kunliang Guan; Addgene plasmid # 13508) using polyethyleneimine ...
-
bioRxiv - Immunology 2022Quote: ... were transduced at 0.3 MOI by both part A and B of the pooled Human GeCKO v2 CRISPR library (Addgene, Cat#1000000049), and subsequently selected using 2 µg/mL puromycin (Calbiochem ...
-
bioRxiv - Cell Biology 2022Quote: ... The pHUJI-LC3B construct was cloned by inserting a codon-optimized gblock encoding pHUJI fused to the N-terminus of human LC3B into the NotI site of pENTR4 (Addgene #17424), and then Gateway-recombined with LR clonase II (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... the same procedure was conducted to create and quantify the one-vector format Brunello human CRISPR knockout pooled library (Addgene #73179,59).
-
bioRxiv - Cell Biology 2022Quote: ... REEP1-mEmerald and REEP1-mCherry plasmids were generated by inserting a codon-optimized human REEP1 gblock into mEmerald-N1 (gift from M. Davidson; Addgene #53976) or mCherry-N1 backbones (Clontech) ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Cancer Biology 2024Quote: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) 19 ...
-
bioRxiv - Immunology 2023Quote: DNA comprised of the human HDAC2 gene with flanking BglII and BamHI restriction sites was synthesized and cloned into pmVenus (L68V)-mTurquoise2 (AddGene #60493) such that a fusion protein of mVenus-HDAC2-mTurqoise2 was produced ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... cells were infected with a lentiviral pool of the Human Brunello CRISPR knockout pooled library (a gift from David Root and John Doench: Addgene #73178) at an MOI of 0.3 and with a coverage of 500 cells per sgRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids constructs pSBbi-RN-FGF19 and pSBbi-BB-FGF15 were respectively generated by cloning the human FGF19 amplified from Huh7 cDNA and the mice Fgf15 amplified from ileum cDNA onto the pSBbi-RN (Addgene #60519) and pSBbi-BB (Addgene #60521 ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Synapsin1 promoter and smFP-HA were PCR amplified from pAAV-hSyn-EGFP (a gift from Bryan Roth, Addgene Plasmid #50465) and pCAG_smFP-HA (a gift from Loren Looger ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-dependent mCherry under the human synapsin promoter in dHPC (AAV5-hSyn-DIO-mCherry, titer: 1.1 × 1013 vg/ml, Catalog #50459-AAV5, Addgene, Watertown, USA). For optogenetic experiments ...
-
bioRxiv - Evolutionary Biology 2023Quote: Full-length human GLI3 and mouse Gli3 cDNAs were obtained from pEGFPC3-hGli3 (a gift from Aimin Liu, Addgene plasmid, (57)) and pCMV-Gli3-Myc-DDK (ORIGENE ...
-
bioRxiv - Cancer Biology 2023Quote: ... the double-stranded oligonucleotide sgRNAs for human FOXM1 sequences were ligated into the BbsI sites of the FgH1tUTG plasmid (Addgene, #70183). sgRNA target sequences were listed in Supplementary Table 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA was generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene #42230) with BbsI digestion (see table S8 for protospacer sequence) ...
-
bioRxiv - Cancer Biology 2022Quote: ... A MYC T58A gene (synthesized by IDT, Coralville, USA, using the human MYC T58A sequence as template from Addgene plasmid # 18773) [69] ...
-
bioRxiv - Cell Biology 2023Quote: The DNA fragment encoding human integrin β5 was amplified from the pCX-EGFP beta5 integrin receptor (a gift from Raymond Birge, Addgene #14996), and then inserted into the pEGFP-N1 vector (Clontech ...
-
bioRxiv - Developmental Biology 2023Quote: An enhanced piggyBac Puromycin selectable and DOX inducible vector was digested with EcoRI-NotI and ligated with PCR-amplified human SOX2 from the FUW-tetO-hSOX2 plasmid (Addgene#20724). Transfection into hPSCs was done using Lipofectamine Stem Reagent per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The transgene was constructed using the Gateway recombination system to introduce the Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into the pHAGE-TRE-DEST-NBioTAP (Addgene #53568) lentiviral vector ...
-
bioRxiv - Cell Biology 2023Quote: The EGFP-tr53BP1 construct was assembled using Gibson Assembly with a fragment of human 53BP1 (amino acids 1221-1709, Addgene #69531) (4 ...
-
bioRxiv - Cell Biology 2023Quote: ... One sgRNA was cloned into pMCB320 as detailed above (see “Generation of Single Knockout Cell Lines with sgRNAs from the Bassik Human CRISPR/Cas9 Deletion Library”) while a second sgRNA was cloned into pKHH030 (Addgene #89358). To clone a sgRNA into pKHH030 ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 12ug of each pTwist Lenti Puro SFFV WPRE lentiviral construct encoding either human or mouse PRLR were co-transfected with 9ug of psPAX2 (Addgene; 12260) and 3ug of pMD2.G (Addgene ...
-
bioRxiv - Immunology 2024Quote: Stable Cas9 expression was established in human B-cell lines (WSU-FSCCL, HBL-1 and SUDHL5) using lentiviral transduction of lentiCas9-Blast (Addgene #52962). Cells were incubated with 10µg/ml polybrene (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... sgRNAs were selected from either the Brunello (human) or Brie (mouse) libraries and cloned into either lentiCRISPR v2 or lentiCRISPR v2-Blast (Addgene #83480). Lentivirus was produced and used to infect indicated cell lines ...
-
bioRxiv - Cancer Biology 2024Quote: ... directed to GFP as non-targeting control (ΔGFP) or to human GDF15 (ΔGDF15) were cloned into the BsmBI (Thermo, #ER0451) site of lentiCRISPRv2-puro vector (AddGene, #52961) using the following pairs of annealed oligonucleotides obtained from IDT for GFP (forward 5’-CACCGGTGAACCGCATCGAGCTGA-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reporters were co transfected with a plasmid carrying the Cas9 gene and a guide RNA for the human AAVS1 locus (pMGS7 Addgene, #126582). Cells were cultured at low density under hygromycin selection (100 µg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... the Pro251 allele was inserted into the green fluorescent protein (GFP)-PLIN2 plasmid (Addgene #87161). Sequences were verified in forward and reverse directions using primers EGFP-N and SV40pA-R ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Biophysics 2020Quote: ... final protein expression constructs were generated by Gateway LR recombination into pDest-566 (Addgene #11517), an Escherichia coli T7–based expression vector based on pET42 and incorporating hexa-histidine (His6 ...
-
bioRxiv - Biophysics 2022Quote: ... pET19b:EcMscLGFP was used previously as an in vitro membrane protein folding reporter (Addgene plasmid # 165097) (Jacobs et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression constructs for various cytoskeleton or organelle marker proteins were obtained from Addgene (S1 Table). For bacterial expression of His6-tagged CAHS proteins ...
-
bioRxiv - Cell Biology 2021Quote: MSCs were transduced with lentiviral particles having mitochondria targeting protein and GFP in downstream (Addgene) and lysosome were stained with lysotracker Deep-Red (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... an artificial transposon with all of the attributes of a protein expression vector (Addgene #120863), and 1 unit of MuA transposase (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: The extracellular domain of ASLV-A envelope protein from the plasmid pAAV-TRE-HTG (Addgene) and the targeting domain encoding the Gbp6 nanobody33 were combined by PCR and cloned into a Piggybac transfer vector under a synthetic constitutive promoter (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...