Labshake search
Citations for Addgene :
1001 - 1050 of 1837 citations for Cystatin C ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... A viral vector (AAV9.Syn.GCaMP6f.WPRE.SV40; Addgene, 1:10 dilution with PBS and mannitol) was then injected through a thin glass pipette with a micropump (UMP-3 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127) was injected bilaterally into the PVH of MC4R-2A-Cre mice (150 nl ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127), together with either AAV1-Syn-Flex-GCaMP6s-WPRE-SV40152 (Addgene 100845-AAV1 ...
-
bioRxiv - Biochemistry 2023Quote: ... and pGEX-6P-1-INTS3-FL (INTS3) were gifts from Yuliang Wu (Addgene plasmids #128307 ...
-
bioRxiv - Neuroscience 2023Quote: ... guillardia theta anion-conducting channelrhodopsin (stGtACR; hSyn1-SIO-stGtACR2-FusionRed; serotype 1; RRID:Addgene_105677) or eYFP alone as a control (AAV-EF1a-DIO-eYFP ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 nL of AAV2/9-hSyn-GCaMP6s (Addgene, titer ≥ 1×1013 vg/mL) was pressure injected into each ocular vitreous through a glass micropipette using a Nanoject (Drumond Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP-targeting shRNA vectors 1 and 2 refer to pLKO1-shYAP1 (Addgene, #27368) and pLKO1-shYAP2 (Addgene ...
-
bioRxiv - Biophysics 2023Quote: ... pLenti CMV rtTA3 Hygro (w785-1) was a gift from Eric Campeau (Addgene plasmid #26730 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.50 µL of AAV5.FLEX.ArchT.tdTomato (diluted 1:2 with dPBS; Addgene number: 28305) was injected in basal forebrain of ChAT-Cre animals using the coordinates described above ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 EF1a-FLEx-taCasp3-TEVp (5.8 × 1012 gp/mL) (Addgene #45580)49
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 hSyn-SIO-stGtACR2-FusionRed (1.9 × 1013 gp/mL) (Addgene #105677)83
-
bioRxiv - Cell Biology 2024Quote: The pLKO.1 – TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV9-CaMKIIa-hM4D(Gi)-mCherry (titer: 1×10¹³ vg/mL, Addgene) and AAV9-CaMKIIa-EGFP (titer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then transfected with 0.5 to 1 μg pCDNA3-HA-hMYCN (Addgene #74163) using JetPrime® (Polyplus Transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... or diluted (1:10 in saline) AAV1-ChrimsonR (Addgene; 1012 vg/mL titre) was co-injected with retrograde GFP (rgGFP ...
-
bioRxiv - Cell Biology 2024Quote: ... and cofilin-1-EGFP (cat no. 50859) were purchased from Addgene (Watertown, MA).
-
bioRxiv - Developmental Biology 2021Quote: ... The predicted r-opsin1 TALENs were constructed in vitro using Golden Gate assembly protocol (Golden Gate TAL Effector Kit 2.0, Addgene #1000000024) [88] ...
-
bioRxiv - Cell Biology 2023Quote: ... Targeting sequence was cloned into pDD162 plasmid by using NEB’s Q5 Site-Directed Mutagenesis Kit to insert the targeting sequence into our Cas9-sgRNA construct (Addgene #47549) by using forward primer 5’-(CAAGCGAAAGAGTCGTCGAA)GTTTTAGAGCTAGAAATAGCAAGT-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids for WT and catalytic mutant mouse Lipin-1 were obtained from Addgene. Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... and then recombined into the destination vector pLenti CMV Blast DEST (706-1, Addgene) plasmid ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 cells were transfected using 0.25µg pCMVHA E2F1 (24225 from Addgene, RRID: Addgene_24225) with a JET PRIME kit (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 cells were transfected using 0.25µg pCMVHA E2F1 (24225 from Addgene, RRID: Addgene_24225) with a JET PRIME kit (Polyplus Transfection ...
-
bioRxiv - Genomics 2020Quote: ... and pMA122 - peel-1 negative selection (Addgene plasmid # 34873; http://n2t.net/addgene:34873; RRID:Addgene_34873) were gifts from Dr ...
-
bioRxiv - Genetics 2020Quote: ... the NLS:LEXA (1-214aa) fragment from the pBPnlsLexA::GADflUw plasmid [35] (Addgene plasmid #26232) was cloned in frame in a myc-BAP170 (2-1688 aa ...
-
bioRxiv - Molecular Biology 2019Quote: ... RACK1-FLAG was cloned into pLenti CMV Puro DEST (w118-1) (Addgene plasmid #17452) following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... pcDNA4 myc PGC-1 alpha was a gift from Toren Finkel (Addgene plasmid # 10974). pSG5 PPAR alpha was a gift from Bruce Spiegelman (Addgene plasmid # 22751) ...
-
bioRxiv - Biochemistry 2019Quote: ... and pFLAG-SREBP2Nt (N-terminal transcriptionally active domain, amino acids 1-482) (Addgene, 26807) were used to transfect cells (HEK293) ...
-
bioRxiv - Neuroscience 2019Quote: The plasmids used for transfection were listed (1) cis plasmid pAAV.hSyn.eGFP.WPRE.bGH (Addgene Cat# 105539) and pAAV-hSyn-eGFP (Addgene Cat# 50465) ...
-
bioRxiv - Immunology 2019Quote: ... AAV carrying Cre-dependent tdTomato cassette (AAV2/1.CAG.Flex.tdTomato.WPRE.bGH, titer ≥1013 vg/mL, Addgene) was injected into the iLN Nav1.8Cre/+ animals as described above ...
-
bioRxiv - Genetics 2020Quote: ... The selected sgRNAs (Table 1) were cloned into plasmid pSpCas9(BB)-PX330 (Addgene #42230), using the BbsI site ...
-
bioRxiv - Bioengineering 2020Quote: Plasmid pcDNA3.1-GFP(1-10) was a gift from Bo Huang5 (Addgene plasmid 70219). The fragment encoding for GFP1-10 was isolated via PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid pEGFP-N1 with a CMV promoter was also used (Addgene #6085-1). All constructs were verified by sequencing (Eurofins and Genewiz) ...
-
bioRxiv - Cancer Biology 2020Quote: ... which will be available through Addgene: (1) SpCas9 sgRNAs expressed using LRG2.1 (Addgene, 108098), (2 ...
-
bioRxiv - Cell Biology 2021Quote: ... pLKO.1 - TRC cloning vector was a gift from David Root (Addgene plasmid # 10878)(89) ...
-
bioRxiv - Neuroscience 2020Quote: ... oChIEF was manufactured by Virovek (AAV2/1.CAG.flex.oChIEF.tdTomato, Addgene 30541, 2.2×1013 GC/ml). For anatomical experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-EF1a-DIO-hChR2-eYFP (UPenn Vector Core AV-1-20298P / Addgene 20298-AAV1) or AAV9-CAG-DIO-ChroME-ST-p2A-H2B-mRuby (generously provided by Hillel Adesnik) ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV1-CamKIIa-hChR2-mCherry (UPenn Vector Core AV-1-26975 / Addgene 26975-AAV1) were used for non-conditional axon labeling ...
-
bioRxiv - Cell Biology 2021Quote: To determine the cytosolic volume of all cell lines pEGFP-N1 (Addgene# 6085-1) was transiently overexpressed ...
-
bioRxiv - Cell Biology 2020Quote: ... according to manufacturer’s instructions with pLenti CMV/TO Puro DEST (670-1) (Addgene 1729).
-
bioRxiv - Cancer Biology 2022Quote: ... or control vectors pGIPZ (Dharmacon) or pLKO.1 (a gift from David Sabatini, Addgene plasmid #1864 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/1-Ef1a-fDIO-hChr2-eYFP was a gift from Karl Deisseroth (Addgene 55639); pAAV2/1-EF1a-DIO-hChR2-eYFP was a gift from Karl Deisseroth (Addgene #20298) ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV2/1-EF1a-DIO-hChR2-eYFP was a gift from Karl Deisseroth (Addgene #20298); AAV2/1-hSyn-fDIO-DTA (NYUAD) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/1-hSyn-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene #50474); AAV(PHP-eb)-hSyn-DIO-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene #44361) ...
-
bioRxiv - Microbiology 2020Quote: ... pLKO.1 - TRC cloning vector was a gift from David Root (Addgene plasmid # 10878) (94) ...
-
bioRxiv - Microbiology 2020Quote: ... pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878)(94) ...
-
bioRxiv - Cancer Biology 2020Quote: ... or pLKO.1-shSIN3A lentiviruses was conducted according to a protocol described by Addgene. Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... HA-SUMO-1 WT plasmid was a gift from Guy Salvesen (Addgene plasmid # 48966). HA-SUMO-2 WT plasmid was a gift from Guy Salvesen (Addgene plasmid # 48967) ...
-
bioRxiv - Biophysics 2021Quote: ... with 1 μg of DNA plasmid vector Cry2Olig-mCherry (purchased from Addgene, number 60032), and then platted on fluorodishes ...
-
bioRxiv - Molecular Biology 2021Quote: ... lentiviruses were produced in HEK293T cells in a pLKO.1-puro (Addgene, plasmid 8453) backbone ...
-
bioRxiv - Genomics 2021Quote: ... IMR90 cells were transfected with 1 µg of pEGFP-Δ50 LMNA (Addgene Plasmid #17653). After expression of the GFP was observed (∼2 days) ...