Labshake search
Citations for Addgene :
1001 - 1050 of 2458 citations for 7 Methylimidazo 1 2 a pyridine 6 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 4×105 HEK 293T cells were transfected with pCDH-EF1-sCTLA-4 expression plasmid (1.5 µg) and psPax2 (2 µg) and pMD2.G (1.5 µg) packaging plasmids (Addgene), using Viafect™ (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-HEK 293T cells were generated using the CRISPR/Cas9 system from Addgene (http://www.addgene.org/). The sequences for guide RNAs were obtained from http://tools.genome-engineering.org and https://www.addgene.org/pooled-library/zhang-human-gecko-v2/ ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received 2 separate unilateral microinjections (males 0.2 µL, females 0.15 µL) of retrograde-transported AAV (AAVretro) constructs (Addgene) in the RVLM and CVLM (RVLM-males ...
-
bioRxiv - Cell Biology 2023Quote: Day 5 moDCs previously transfected with either NT or gal9 siRNA were transfected with 2 ug of the Str-KDEL_TNFα_SBP_EGFP plasmid (Addgene, #65278) (Boncompain et al ...
-
bioRxiv - Biochemistry 2023Quote: ... P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746; http://n2t.net/addgene: 23746; RRID:Addgene_23746) (Johannessen et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pWPXLd-OGT-GFP fusion vector was described in our previous articles,(2) pET24a-ncOGT-FL (190821, Addgene), other plasmids were cloned into pcDNA3.1 backbone with c-myc or HA tag ...
-
bioRxiv - Synthetic Biology 2024Quote: ... were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677; http://n2t.net/addgene:72677; RRID:Addgene_72677) or alternatively ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Gentamicin-R and Kanamycin-R) were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677 ...
-
bioRxiv - Cell Biology 2022Quote: Kinesin-1-GFP: Plasmid coding for kinesin-1-GFP was purchased from Addgene repository (#129761) ...
-
bioRxiv - Biophysics 2022Quote: ... Kinesin 1 1-401 (K401) was PCR amplified from pWC2 plasmid (Addgene # 15960). Ncd 236-701 was PCR amplified from a plasmid gifted by Andrea Serra-Marques.
-
bioRxiv - Cancer Biology 2019Quote: ... 293T cells were transfected with the sgRNA vector and a 1:1:1 mixture of lentiviral packaging constructs (Addgene #12251, #12253, #8454) using polyethylenimine transfection reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.6-0.8 uL of a 1:1 mixture of GAD1-cre and mCherry virus (AAV8-hSyn-DIO-mCherry, ≥ 1×101 3 vg/mL; Addgene, Watertown, MA, USA) was injected bilaterally into VP ...
-
bioRxiv - Microbiology 2022Quote: ... or pLKO.1-blast (pLKO.1-blast was a gift from Keith Mostov (Addgene plasmid #26655 ...
-
bioRxiv - Neuroscience 2021Quote: ... Constructs included: AAV2/1-hSynapsin-1-jGCaMP8 constructs (pGP-AAV-syn1-jGCaMP8f-WPRE, Addgene plasmid #162376 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 1 μl of AAV5-hSyn-DIO-mCherry (1012 particles.ml−1, Addgene, #50459-AAV5). The virus was infused at a rate of 0.2 μL.min−1 using microinjection cannula (33-gauge ...
-
bioRxiv - Molecular Biology 2020Quote: ... were diluted (1:100) and cloned into pLKO.1 TRC-Cloning vector (Addgene # 10878) that had been digested with EcoRI and AgeI ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μL of AAV9-hsyn-cre-2a-tdT (Addgene#107738, titer ∼1×10^13) was diluted with 3 μL of PBS and was injected into the subarachnoid space of one hemisphere at the level of somatosensory cortex in Mtor-floxed-5XFAD mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... apr-1 and ecps-1 were obtained from a library supplied by Ahringer (Addgene) (Kamath et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... ZIF-1 and GFP-nanobody::ZIF-1 sequences were amplified from pOD2046 (Addgene #89367) (Wang et al ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Molecular Biology 2020Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 d with pXPR_011 lentivirus expressing eGFP (Addgene; 59702) and an sgRNA targeting eGFP at a multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Systems Biology 2021Quote: ... We generated two independent miR-290-295_KO mESC lines by transfecting WT E14 mESCs with pX458-sgRNA_miR290-295_3/2 for KO1 (Addgene #172711, #172710) and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710) ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Two closely spaced NHSL1 specific sgRNA (sgRNA1: caccgTCGACTCTCCTCGTCCAAGT; sgRNA2: caccgCTGTCCACTACACGGCACCA) were designed using http://crispr.mit.edu and cloned into pX330S-2 (Addgene 58778) and pX330A_D10A_x2 (Addgene 58772 ...
-
bioRxiv - Molecular Biology 2022Quote: The lentiviral vectors pLVX-EF1alpha-IRES-Puro-2xStreg-SARS-CoV-2 (Nsp6, Nsp8, M) (Addgene plasmids #141395, #141372, #141374) were transfected into the HEK293T cells with packaging plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068 ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Neuroscience 2019Quote: ... 5.2×1012 gc/ml) and AAV2/5-hSyn-DIO-hM3Dq-mCherry (7.8×1012 gc/ml) were produced from Addgene plasmids #44362 and #44361 at the facility of Nantes University (UMR 1089 ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA-FLAG-V5-Nsp10/14/16 vectors were constructed from pDONR223 SARS-CoV-2 Nsp10 (Cat. # 141264, Addgene), Nsp14 (Cat ...
-
bioRxiv - Immunology 2021Quote: ... Virus was harvested from GP-2 cells transfected with SINV vectors and VSV-G (pMD2.G, Addgene plasmid #12259) and grown in DMEM supplemented with 30% FBS and 2mM glutamine ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs from the library (Supplemental Table 2) were annealed and cloned into a pLKO.1_neo plasmid (a gift from Sheila Stewart; Addgene plasmid # 13425 ...
-
bioRxiv - Neuroscience 2020Quote: ... mEos3.2-C1 was a gift from Michael Davidson & Tao Xu (Addgene plasmid # 54550; http://n2t.net/addgene:54550; RRID: Addgene_54550). Vcl-T-mEOS3.2-LifeAct was generated by sub-cloning a Vcl-T-T2A fragment in mEOS3.2-LifeAct clone.
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260), and pMD2G envelope plasmid (4 µg ...
-
bioRxiv - Molecular Biology 2022Quote: A single guide RNA (sgRNA) (GCAGTGACTGTGTACGTGAG) that targets exon 2 of eIF2D was cloned into lentiCRISPR v2 plasmid (Addgene). HEK293 cells were plated into 6-well plates at 4 × 105 cells per well ...
-
bioRxiv - Neuroscience 2022Quote: ... excitatory Gq-coupled DREADDs (hSyn-hM3Dq-mCherry-AAV1/2 viral stocks, 4.0 × 1011 GC/mL titer, plasmid #50474 from Addgene), and control construct (hSyn-enhanced green fluorescent protein (EGFP)-AAV2 1:10 dilution of viral stocks ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagging of the endogenous locus of SMC3 was done according to the CRISPaint protocol57 using 2.5 μg frame selector plasmid (pCAS9-mCherry-Frame+2; Addgene_6694157), 2.5 μg target selector plasmid (pCS446_pSPgSMC3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were produced in HEK293T cells using packaging and envelope constructs pCMVΔ8.2 and pMD.G-VSV-G (pCMVΔ8.2 and pMD.G-VSV-G were gifts from Bob Weinberg, Addgene plasmids #8454, #8455), and concentrated using fast-trap virus purification and concentration kit according to manufacturer′s instructions (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... into the DR and bilateral infusions of AAVretro-hSyn-DIO-EGFP (200 nL over 2 min; 1.3 x 1013 GC/mL, Addgene) into the BLA ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Systems Biology 2023Quote: ... psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260)) ...
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255; http://n2t.net/addgene:141255; RRID: Addgene_141255). NSP1 coding sequence was cloned into the mammalian expression pCDNA5-FRT/TO-2xSTREP-3xHA vector ...
-
bioRxiv - Neuroscience 2023Quote: ... and after 2 weeks of expression injected AAV8-EF1a-Con-Foff 2.0-GCamp6m-WPRE into PL (Addgene 137120-AAV8). For recordings from PL-VTA neurons ...
-
bioRxiv - Cell Biology 2023Quote: ... were ordered from Sigma Aldrich as oligonucleotides (Table 2) and were cloned into pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138 ...
-
Structural and mechanistic insights into disease-associated endolysosomal exonucleases PLD3 and PLD4bioRxiv - Biochemistry 2023Quote: ... PLD3 KO cell line was generated from HEK293BlueTM hTLR9 by transfecting 2 μg hSpCas9-sgRNA expressing plasmid (Addgene #99154) cloned with gRNA sequence 5′-guccucauucuggcgguugu-3′ ...
-
bioRxiv - Neuroscience 2024Quote: Mice were injected with AAV1-mDlx-GCaMP6f-Fishell-2 (titer: 4.43E13; developed in the lab of Gordon Fishell; purchased from Addgene: plasmid #83899 ...
-
bioRxiv - Microbiology 2024Quote: All sgRNA oligonucleotides (Supplementary Table 2) were obtained from MilliporeSigma and cloned into the pLentiGuide-Puro plasmid (Addgene, #53963) as previously described 51,52 ...
-
bioRxiv - Molecular Biology 2020Quote: ... residues 1-271 (Addgene #138421), and residues 1-133 (Addgene #138422 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PLKO.1 (Addgene, #10878 [34]), for expression of Cas12a gRNAs ...