Labshake search
Citations for Addgene :
1001 - 1017 of 1017 citations for 6 Benzyloxy 1H indole 2 boronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Cell Biology 2024Quote: ... was amplified and inserted by In-Fusion cloning between myo-2 promoter driving mCherry and unc-54 3’UTR of pCFJ90 (Addgene #19327; Watertown, MA) to generate plasmid pKM3 ...
-
bioRxiv - Neuroscience 2024Quote: ... Gq DREADD virus (n=23, 12 males, 11 females: AAV8-hSyn-DIO-hM3Dq-mCherry, ≥ 4×101 2 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express excitatory designer receptors in VP GABA neurons ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Microbiology 2021Quote: ... the open reading frame was amplified by PCR from the pDONR223 SARS-CoV-2 NSP5 plasmid (Addgene, #141259, a gift from Fritz Roth [32]), including an ATG start codon in the forward primer and a TAA stop codon in the reverse primer (MPro_Fw ...
-
bioRxiv - Immunology 2020Quote: ... pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-SARS-CoV-2-S-RBD-sfGFP plasmids were gifts from Erik Procko (Addgene plasmids #145163 and #141184). pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Neuroscience 2023Quote: ... Michael Ward and the 2 CLYBL targeting TALEN plasmids (pZT-C13-R1 and pZT-C13-L1, gifts from Jizhong Zou Addgene.org: #52638 and 52637, respectively) by the same method with the Neon Transfection System (40) ...
-
bioRxiv - Neuroscience 2023Quote: Foreskin fibroblasts were transfected with the AAVS1-DOX-KRAB-dCAS9 plasmid and the 2 AAVS1 Talen plasmids (Gifts from Danwei Huangfu, Addgene plasmid # 59025 and 59026) using the Neon Transfection system (38) ...
-
bioRxiv - Cell Biology 2024Quote: ... The FAP-tagging plasmids and those expressing these FAP-tagged cellular markers are all available on Addgene (see Supplemental Table 2 or Addgene global deposit number 84326). Plasmids were transformed into yeast cells using the lithium acetate method (Ausubel ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2023Quote: 750 nl of rAAV.EF1a.DIO.hChR2(H134R).eYFP or rAAV.EF1a.DIO.eYFP (3-4 x 10^12 vg/ml, AAV5, University of North Carolina Vector Core; 1-2 x 10^13 vg/ml, AAV1, Addgene, 27056-AAV1 and 20298-AAV1) were injected into each hemisphere of the VTA of 3–4-month-old DAT-Cre mice ...
-
bioRxiv - Neuroscience 2024Quote: ... The efficiency of viral-genetic receptor KO was established in an separate experimental cohort of Esr1loxP or PRloxP animals which received unilateral MPOA injections of either AAV2/5-CMV-EGFP-Cre (250 nl, Addgene 105545, 2 × 1013 GC / ml) or AAV2/5-CMV-EGFP (250 nl ...
-
bioRxiv - Microbiology 2024Quote: ... pcDNA-V5-NSP3 was generated by amplifying the full-length NSP3 ORF from pDONR207 SARS-CoV-2 NSP3 (Addgene #141257; a gift from Fritz Roth (86)) and by subcloning it into the pcDNA3-C-V5 vector ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each dsDNA was injected into CB4088 hermaphrodites at a final concentration of 10 µM with 9 ng plasmid pCFJ90 (Addgene #19327, myo-2>mCherry::unc-54 ‘UTR) as an injection marker ...