Labshake search
Citations for Addgene :
1001 - 1050 of 1612 citations for 5 Pyrimidinecarbonitrile 4 6 diamino 2 methoxy 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA targeting Pml exon 1 (Table 4) was subcloned into the pSpCas9 (BB)-2A-Puro plasmid (pX459v2, Addgene) and transfection of mESCs was performed using lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Cell Biology 2023Quote: ... The RAD52KO cell line was generated from the RAD52WT line by CRISPR-Cas9-mediated deletion of the 1.1kb region between exons 3 and 4 using guide RNAs sg1 and sg2 cloned into px330 (Addgene #42230) as previously described (Kelso et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were then transduced with lentivirus containing the plasmid pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep # 17446-LV; RRID: Addgene_17446)] at a multiplicity of infection of 10 with 8 μg/mL polybrene (hexadimethrine bromide [Cat # 107689 ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 7; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Neuroscience 2024Quote: Rats were anesthetized with isoflurane (induction: 4%; maintenance: 1–2.5%) and received either AAV8-hSyn-hM4Di-mCherry (Addgene #50475-AAV8) or AAV8-hSyn-mCherry (Addgene #114472-AAV8) ...
-
bioRxiv - Microbiology 2024Quote: ... annealing to exon 4 of the ORF of the human BST2 gene was designed and cloned into lentiCRISPR v2 (Addgene). Next ...
-
bioRxiv - Neuroscience 2021Quote: ... working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9; http://n2t.net/addgene:100833; RRID:Addgene_100833). pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Cell Biology 2021Quote: ... For the Tg(fliEP:loxRFPlox:DNtal) construct the 5’ entry clone 478 p5Efli1ep was a gift from Nathan Lawson (Addgene plasmid # 31160 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting scFv fragments were further amplified using the 5’ and 3’ primers (scFv primer_s and scFv primer_as) and cloned into the psfGFP-N1 vector (Addgene #54737 ...
-
bioRxiv - Systems Biology 2022Quote: A Myd88-targeting guide RNA (5’-TCGCGCTTAACGTGGGAGTG-3’) was cloned into the pX330 plasmid backbone (Addgene Plasmid #42230) and transfected using electroporation (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (serotype AAV1, viral titer ≥ 5×1012 vg/mL; Addgene, Watertown, MA, USA), pAAV-hSyn-hM4D(Gi)-mCherry (serotype AAV retrograde ...
-
bioRxiv - Microbiology 2022Quote: ... The target sequence for the ACE2 gene (5′-TGCTGCTCAGTCCACCATTG-3′) was designed using CRISPR direct (https://crispr.dbcls.jp) and cloned into plentiCRISPR plasmids (21) (Addgene plasmid #52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ; http://n2t.net/addgene:104964 ; RRID:Addgene_104964) and 64.6 μg of either the CalEx plasmid (pZac2.1-GfaABC1D-HA-hPMCA2w/b ...
-
bioRxiv - Molecular Biology 2022Quote: ... a sgRNA sequence cutting near MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) was cloned into lentiCRISPR v2 plasmid (Addgene #52961). The Tyrosine to Alanine point mutation was introduced using single-strand Ultramer DNA Oligonucleotide (IDT) ...
-
bioRxiv - Cell Biology 2019Quote: ... replacing the mCherry coding sequence in pFA6a-mCherry:Hph with the coding sequence for the photo-switchable fluorescent protein mEOS3.2 (5) (Addgene) by standard restriction-digestion cloning (using restriction enzymes BamHI and AscI ...
-
bioRxiv - Cell Biology 2021Quote: mApple-Alpha-5-Integrin-12 was a gift from Michael Davidson (Addgene plasmid # 54864; http://n2t.net/addgene:54864; RRID:Addgene_54864) mCherry-Clathrin LC-15 was a gift from Michael Davidson (Addgene plasmid # 55019 ...
-
bioRxiv - Genomics 2022Quote: ... 5 μg DNA was incubated with1.75 μg pMD2.G and 3.25 μg pCMV-dR8.91 (Addgene, Watertown, MA; #12259). On the next day ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ LTR of BLV was synthesized and cloned in (pTripCMVGFP) by Genescript.The commercial plasmids Lenti DR8.75 (Addgene #22036) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2024Quote: ... c-Myc-5-HT2A was a gift from Javier Gonzalez-Maeso (Addgene plasmid # 67944 ; http://n2t.net/addgene:67944 ; RRID:Addgene_67944). 3xHA-5HT2a plasmid was purchased from cDNA Resource Center ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 × 106 293T cells were seeded in a 10-cm plate 1 d prior to transfection and co-tranfected with the 3rd generation lentiviral packaging plasmids (5 µg pVSV.G, 3 µg pMDLg/pRRE, and 2.5 µg pRSV-Rev; Addgene # 14888 ...
-
bioRxiv - Plant Biology 2023Quote: ... in a one-step restriction-ligation reactions with a double CaMV35s-ΩTMV promoter/5′ UTR (pICH51288; Addgene #50269), a C-terminal GR tag (pEPOZ0CM0137 ...
-
bioRxiv - Genetics 2023Quote: ... and the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897, kind gift from Dr. Peter Varnai) (Tóth et al. ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... Transfection control contained 5% pEGFP puro (a gift from Michael McVoy, Addgene plasmid #45561(Abbate et al. 2001)) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454) using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two guide RNA sequences were selected to target exon 1 of mtIF3 as described previously (5′-GCAAUAGGGGACAACUGUGC-3′ and 5′-GCAGAGUAUCAGCUCAUGAC-3′) 59 and cloned into the pL-CRISPR.EFS.GFP (a gift from Benjamin Ebert, Addgene plasmid # 57818 ...
-
bioRxiv - Genomics 2024Quote: ATF4 reporter Viral particles were made from pSMALB-ATF4.5 vector (a gift from John Dick & Peter van Galen; Addgene plasmid # 155032; http://n2t.net/addgene:155032; RRID:Addgene_155032) pseudotyped with the vesicular stomatitis virus G (VSVG ...
-
bioRxiv - Microbiology 2024Quote: ... The 5’ p230p and 3’ p230p targeting sequences were cloned into the pPbU6-hdhfr/yfcu plasmid (Addgene #216422),44 carrying the dual positive and negative selection marker hdhfr-yfcu (human dihydrofolate reductase/yeast cytosine deaminase and uridyl phosphoribosyl transferase ...
-
bioRxiv - Microbiology 2024Quote: ... pLenti PGK GFP Puro (w509-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 19070 ; http://n2t.net/addgene:19070 ; RRID:Addgene_19070). The PGK-UL12.5-SPA plasmid was generated by cloning UL12.5-SPA from pLenti CMV Neo UL12.5-SPA 29 ...
-
bioRxiv - Molecular Biology 2024Quote: ... ESCs were co-transfected with a plasmid expressing Cas9 protein and the gRNA sequence targeting the NPM1 locus (pX330 Mouse 5’ Npm1 gRNA, a gift from Mark Groudine, Addgene plasmid #127900; http://n2t.net/addgene:127900; RRID:Addgene_127900) and the HDR donor plasmid derived from Mouse 5’ Npm1-AID-GFP-PuroR plasmid (a gift from Mark Groudine ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Biophysics 2022Quote: ... or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A) (Addgene plasmid # 141371) plasmid in 96-well white flat bottom plates ...
-
bioRxiv - Immunology 2021Quote: ... with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene). The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... detailed in supplementary table 2) were designed using CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and cloned into pDD162 (Addgene). The sgRNA/Cas9 vectors were injected into adult C ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... All RVdG-CVS-N2c plasmids presented in this study are available from Addgene (Supplementary table 2).
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168; http://n2t.net/addgene:85168; RRID:Addgene_85168). The resulting plasmids were then transformed into Shewanella using electroporation (56) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812; http://n2t.net/addgene:22812; RRID:Addgene_22812). All amplification reactions were performed using Q5 high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255; (Zhang et al, 2014)) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.