Labshake search
Citations for Addgene :
1001 - 1050 of 2576 citations for 4S 6 8 difluoro 3 4 dihydro 2H 1 benzopyran 4 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: C-terminal endogenous tagging of loci was performed in TgPRUΔKu80ΔHXGPRT by targeting the 3’UTR of ROCY1 with a specific gRNA cloned into the pUniversal-CAS9 plasmid (Addgene #52694) and then co-transfected with a homology repair cassette amplified from the pLIC-HXGPRT plasmid (as outlined in (Fox et al. ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... eft-3::hpo-9 or BTBD9 alone were co-injected into tm3719 strain with pG2M36 (myo-3::dsRed) and pBCN27-R4R3 (rpl-28::PuroR, Addgene), which were used as the selective markers for transformation ...
-
bioRxiv - Genomics 2022Quote: ... 12 μg of plasmid library was cotransfected with 9 μg psPAX2 and 3 μg pMD2.G (Addgene #12260 and #12259) into HEK293FT cells using 72 μl Lipofectamine 2000 (Life Technologies #11668019) ...
-
bioRxiv - Genetics 2022Quote: ... with 5’ KpnI and 3’ EcoRI sites (primers LC127 and 128) into the corresponding restriction digestion sites of pLP9 (Addgene plasmid #1497 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The CRISPR line robo1ΔWIRS was generated by cloning a guide targeting the WIRS motif into a pCFD3-dU6:3 backbone (Addgene, #49410) and sending positive clones to BestGene Inc ...
-
bioRxiv - Immunology 2021Quote: ... Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG, Addgene), myc (pCSF107mT-GATEWAY-3’-Myc tag ...
-
bioRxiv - Cell Biology 2021Quote: Using the Neon transfection system pre-set program #16 (1400V, 20ms, 3 pulses) plasmids used for reprogramming (available from Addgene) were EN2L ...
-
bioRxiv - Genetics 2020Quote: ... Plasmids generated for this work for heat shock Cas9 expression (pJJF152) and proof of concept sgRNAs (targeting SECGFP, dpy-10, sqt-3) will be available from Addgene as indicated in a supplementary table or for specific sgRNAs upon direct request from the authors.
-
bioRxiv - Biochemistry 2020Quote: ... we used plasmids encoding hDicer 3’-pocket double mutant (Y926F, R927A), and the 5’-pocket sextuple mutant (R778A, R780A, R811A, H982A, R986A, R993A) (23) (Addgene). PCR fragments were subsequently cloned into the pMCSG7 vector (courtesy of Laboratory of Protein Engineering ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-hSyn-SIO-stGtACR2-FusionRed (Fig. 2F,G and Supplementary Movie 3; Vigene Biosciences; 2.5 x 1012; Addgene plasmid #105677); AAV1-hSyn-DIO-TVA66T-tdTomato-CVS-N2cG (Fig ...
-
bioRxiv - Developmental Biology 2021Quote: ... gRNAs targeting exon 3 of the zebrafish atg13 orthologue (Ensembl: ENSDART00000052324.6; zgc:63526) were cloned into the pT7-gRNA plasmid (Addgene #46759) and generated according to Jao et al ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Immunology 2021Quote: ... the short guide RNAs (sgRNAs) targeting the signaling peptide (5’-GAGTAGCGCGAGCACAGCTA - 3’) was cloned into lentiCRISPR v2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the guide RNA targeting HDAC6 exon 5 (5’-GAAAGGACACGCAGCGATCT-3’) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961). The HDAC6-KO vector can also express the codon-optimized Cas9 protein as well as puromycin resistance gene ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Cell Biology 2023Quote: ... The PAC sgRNA (5′-TGTCGAGCCCGACGCGCGTG-3′) (Lambrus et al., 2016) was cloned into the pSpCas9(BB)-2A-GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’ ...
-
bioRxiv - Biochemistry 2023Quote: The 6xHis-SUMO-14-3-3ζ construct used in this work (kind gift of prof. B.M. Burmann) was derived from GST-14-3-3ζ (Addgene #13278)26 ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were electroporated at DIV0 just before plating with 3 µg of the plasmid control encoding for Td-tomato alone (pCAG td Tomato, Addgene) or 3 µg of plasmid encoding for Cre-recombinase and reporter gene Td-tomato (pCAG td Tomato-Ires-Cre ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Genomics 2023Quote: ... we designed a gRNA that targets the 3’ end of the SOX2 stop codon (Supplementary Table S25, Addgene plasmid #163752). We then amplified ∼800 bp homology arms upstream and downstream of the gRNA target sequence using high-fidelity Phusion Polymerase ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (300 nL; 3×1011 GC/ml; Serotype:9; Addgene, Massachusetts, USA) was unilaterally injected into the right MePD using a 2-μL Hamilton micro syringe (Esslab ...
-
bioRxiv - Neuroscience 2022Quote: Virus expression: pulled glass pipettes were used to inject 500nL of AAV5-mDIx-Chr2-mCherry-Fishell-3 (plasmid no.83898, Addgene, USA ...
-
bioRxiv - Developmental Biology 2024Quote: ... MegaGate was utilized to insert ORFs into the final PB-cT2G-cERP2 3’ UTR barcode-modified expression vectors (Addgene 175503). Three unique barcodes were selected for each ORF with an average hamming distance of six ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence of a single guide RNA (sgRNA) specifically targeting the 3’ end of TGRH88_003980_t1 was integrated into pSAG1::CAS9-GFPU6::sgUPRT (Addgene plasmid # 54467) using the Q5-site directed mutagenesis kit (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: To generate RAD54L2 knockouts a double-stranded DNA oligo encoding a sgRNA targeting the RAD54L2 5’ region from the TKOv3 library (Hart et al, 2017) (5’-AAGATGGGCAGCAGCCGCCG CGG–3’) was cloned into pSpCas9(BB)-2A-Puro (PX459) (RRID: Addgene_48139) to yield PX459-RAD54L2.
-
bioRxiv - Neuroscience 2024Quote: ... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
bioRxiv - Neuroscience 2024Quote: ... the ReaChR virus was co-injected unilaterally into the LC with AAV9-hSyn-FLEX-jGCaMP8m (3 × 1013 gc/mL, 162378-AAV9 from Addgene) or with AAV9-hSyn-GRABNEm (2-9 × 1013 gc/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... From 5’ to 3’ the constructs consist of a Tet-On doxycycline inducible promoter (a gift from David Root (Addgene plasmid # 41393 ...
-
bioRxiv - Genetics 2024Quote: HeLa CRISPRi cells were generated by lentiviral integration (∼3 to 5 MOI) using the dCas9-KRAB-blast plasmid (Addgene #89567), followed by single cell isolation ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Biochemistry 2023Quote: ... IGF2BP3: 5’-ACGCGTAGCCAGTCTTCACC-3’) were cloned into the pSpCas9 (BB)-2A-GFP (PX458) (plasmid #48138; Addgene, (Ran et al. 2013)) ...
-
bioRxiv - Genomics 2024Quote: ... and the top 3 sgRNAs were individually cloned into single sgRNA expression vectors with direct capture cs1 sequences (Addgene # 122238)10 using restriction digest (BstXI and BlpI ...
-
bioRxiv - Immunology 2022Quote: ... HHLA2 cDNA included 5’ EcoRI and 3’ NotI sites and was cloned into the pBMN-IRES-GFP vector (Addgene #1736). PCR (Q5 enzyme ...
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Suppl. Table 3) in the BbsI restriction sites of pX459 (#62988, Addgene). An empty pX459 vector was used to generate matching negative control cell lines ...
-
bioRxiv - Neuroscience 2022Quote: ... using an ultra-fine dental drill and inserted a glass pipette backfilled with AAV2-CamkIIa-hChR2(H134R)-EYFP (titer: 3×10¹² viral genomes per ml, 26969-AAV2, Addgene). AC was approached similar to extracellular recordings ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Cell Biology 2023Quote: eGFP with three perfect miR430 target sites in its 3’UTR (eGFP-3xPT-miR430b) was inserted in the pCS2+ plasmid (Addgene) as described before 24 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The guide sequence used was 5’-TCTCTGAGTGCCAACGCGCG-3’ and was cloned into the BbsI site of pX459 vector (Addgene #62988). The gene targeting was performed by co-transfection of pX459 and the synthetic donor vector into B6N 6.0 embryonic stem cells using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 µg of mouse Lamin B1 or Lamin B2 or Lamin B3 plasmids conjugated with myc-tag (pCS2-MT, Addgene). Cells were incubated for 48h in a DMEM cultivation medium (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNAi clone that targets the 3’UTR of cdc-42 was generated through amplification of genomic cdc-42 3’UTR (Fwd: gaagatctgaacgtcttccttgtctccatgt; Rev: ggggtaccacgtaacggtgtatccggac) and insertion into the L4440 plasmid (#1654 Addgene). Control bacteria is transformed with empty L4440 vector (#1654 Addgene).
-
bioRxiv - Neuroscience 2024Quote: ... For the VIP silencing experiments (Figure 7H) 3 VIP-Cre mice were injected with a mixture of viruses expressing GcaMP7f (pGP-AAV9-syn-jGCaMP7f-WPRE, Addgene) and Cre-dependent ArchT (pAAV-FLEX-ArchT-tdTomato (AAV5) ...
-
bioRxiv - Microbiology 2024Quote: ... second transduction was performed 3 days after the addition of puromycin using pLenti SpBsmBI sgRNA Hygro vector (Addgene, Plasmid # 62205) harboring the IMPDH2 sgRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... -2.2 mm ventral from skull under an angle of 10°) and injected with AAV5-hSyn-DIO-mCherry (3*10^12 gc/ml; 300nl; Addgene) in LHA (-1.3 mm posterior to bregma ...
-
bioRxiv - Cell Biology 2024Quote: The monoclonal SK-N-DZ SCLYKO cell line was transduced with Toronto KnockOut (TKO) CRISPR Library - Version 3 (Addgene, 90294) at MOI of 0.3 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... . The 293 T cells were transfected with pLVX-TFAP2B-3×Flag together with psPAX2 and pMD2.G lentiviral packaging systems (Addgene) to generate TFAP2B stably overexpressed cell lines.
-
bioRxiv - Cancer Biology 2024Quote: ... targeting a DNA sequence within the first exon of the FasL gene (5’-CTGGGCACAGAGGTTGGACA-3’) was cloned into the BsmBI restriction site of the 3rd generation LentiCRISPR.V2 (Addgene, #52961) vector ...
-
bioRxiv - Molecular Biology 2024Quote: We cloned two previously published gRNA sequences (13) targeting 5’ or 3’ of the SCR into a Cas9 expressing px330 backbone (#158973, Addgene) according to the protocol published by the Zhang lab (38) ...