Labshake search
Citations for Addgene :
1001 - 1050 of 2473 citations for 4 Chloro 6 fluorobenzene 1 3 diamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... was either mutagenized in a 3 kb cloning plasmid (pKSPS (Bahri et al., 2021)) before subcloning into pQCXIB (the retroviral expression vector, Addgene plasmid #22800) or was directly mutagenized in pQCXIB ...
-
bioRxiv - Developmental Biology 2023Quote: ... were transfected with 3 μg targeting vector pUC19-OCT4-T2A-NLS-EmGFP-P2A-Puro (kind gift from Timo Otonkoski; Addgene plasmid #89992) and 3 μg of PX459 plasmid (kind gift from Feng Zhang ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’ and 3’ fragments containing incorporated mutated gene ORF sequences were amplified by PCR from the pDONR223-TP53 WT plasmid (Addgene; Plasmid #82754). In this case ...
-
bioRxiv - Cancer Biology 2023Quote: ... and non-targeting sgRNA controls (SCR; supplementary table 3) flanked with BsmBI overhangs were ligated into the vector FgH1tUTG-GFP (Addgene Plasmid #70183) using 1uL BsmBI (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we designed a construct for the first tier of the dCas9-based cascade that is expressed from the EF1α promoter and contains a SapI-flanked cloning site in the 3’UTR for adding a gRNA to target a downstream target: “EF1a-Triplex-28-M13-28-pA” (Addgene ID 202041). Detailed protocols for modifying all of these constructs are provided on the Addgene website.
-
bioRxiv - Molecular Biology 2024Quote: ... WTC-11 iPSCs were electroporated with the corresponding homology plasmid (3 µg per electroporation) and two TALEN plasmids (0.75 µg per electroporation each) targeting the AAVS1 locus (Addgene, #52341 and #52342). iPSCs were dissociated into a single cell suspension ...
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Microbiology 2024Quote: ... sequence targeting the third exon of the human L1CAM gene (5’-GAGTAGCCGATAGTGACCTG-3’) was designed and cloned into the pKLV2-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene plasmid #67974). For the production of lentiviral particles carrying the CRISPR/Cas9 components ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR donor plasmids were cloned with 0.8 kb 5’ and 3’ homology arms amplified from fly genomic DNA into pUC57(Addgene plasmid #51019, RRID:Addgene_51019), flanking the different CTail Shot-eGFP coding sequences ...
-
bioRxiv - Cancer Biology 2024Quote: ... or an sgRNA against PTEN (sgPTEN: 5’-GAC TGG GAA TAG TTA CTC CC -3’) in the LCV2-hygro backbone (Addgene Plasmid #98291), or infected with the pHRIG-AKT1 lentiviral construct (Addgene ...
-
bioRxiv - Genetics 2024Quote: ... carrying an sgRNA (5’-AAGGAAACTAAGACGTGCGA-3’) and two plasmids carrying mAID-mClover flanked by XPG sequences and a neomycin casette (pMK289, Addgene plasmid #72827) or a hygromycin cassette (pMK290 ...
-
bioRxiv - Cell Biology 2021Quote: ... For CRISPR Cas9 KO generation two gRNA directed to exon 4 and exon 5 (Table M1) were cloned in pSpCas9 (BB)-2A-Puro V2.0 (Addgene #62988).
-
bioRxiv - Molecular Biology 2021Quote: ... targeting a coding sequence of exon 4 in SETX was inserted into the BbsI site of pX330 (plasmid 42230, Addgene) as described (103 ...
-
bioRxiv - Neuroscience 2020Quote: ... SOM and PKCδ Cre mice were injected with 300 nl of AAV8.hSyn Pr.DIO.hM3Dq-mCherry (≥ 4×1O12 vg/mL; Addgene #44361-AAV8) or AAV9.hSyn Pr.DIO.hM4Di-mCherry (≥ 1×1013 vg/mL ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were then transduced with lentivirus containing the plasmid pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep # 17446-LV; RRID: Addgene_17446)] at a multiplicity of infection of 10 with 8 μg/mL polybrene (hexadimethrine bromide [Cat # 107689 ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 5; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 7; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Microbiology 2024Quote: ... annealing to exon 4 of the ORF of the human BST2 gene was designed and cloned into lentiCRISPR v2 (Addgene). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... we microinjected a 1:1 ratio of AAV1.hSyn.GCaMP6s.WPRE.SV40 (Addgene) and the somatically targeted AAV1.hSyn.ChrimsonR.mRuby2.ST (University of Minnesota Viral Vector and Cloning Core ...
-
bioRxiv - Genetics 2021Quote: ... Cas9 and dCas-VP64 Calu-3 knock-in lines were then transduced with Brunello and Calabrese Set A libraries (Addgene #73179 and #92379) as appropriate ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Molecular Biology 2022Quote: ... Conditional knockout cells were generated by infection with media from a confluent 10 cm dish of 293T cells transfected with 3 µg pCL-Eco (Addgene, 12371 ref (17)) and 3 µg MSCV CreERT2 puro (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... containing 40bp of the 5’ end of cobK to a second 923-bp PCR-generated fragment (FR2) containing 107bp of the 3’ end of cobK in a three-way ligation reaction with p2NIL backbone (Addgene plasmid #20188; (46)) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 80-100nl of either AAV5-hSyn-hChR2(H134R)-EYFP (UNC Vector core) or pAAV9-mDlx-ChR2-mCherry-Fishell-3 (Addgene viral prep # 83898) was injected into the right GPi or SNr ...
-
bioRxiv - Neuroscience 2024Quote: ... DREADD+ group) was bilaterally injected in the dDG with pAAV5-CaMKIIa-hM4D(Gi)-mCherry (virus titer ≥ 3×1012 vg/ml, Addgene, North Carolina, USA). Inhibitory DREADDs are activated by the artificial ligand clozapine-N-oxide (CNO ...
-
bioRxiv - Genetics 2024Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722, originally from 29). Library1 ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified and inserted by In-Fusion cloning between myo-2 promoter driving mCherry and unc-54 3’UTR of pCFJ90 (Addgene #19327; Watertown, MA) to generate plasmid pKM3 ...
-
bioRxiv - Cell Biology 2024Quote: Suitable gRNA target sites (5 ′ gRNA: GGAGGCTCTCGTGCCGGCTC, 3 ′ gRNA: GCTATAGGAAGCCACCGTTA) were identified by CRISPR optimal target finder 45 and cloned into pCFD5 (Addgene plasmid #73914; 46) via Gibson assembly (NEB).
-
bioRxiv - Cell Biology 2021Quote: ... pLKO.1 (Addgene plasmid 8453 ...
-
bioRxiv - Neuroscience 2021Quote: ... a 1:1 mixture of AAV9-hSyn-Cre (1:40000 dilution, Addgene: 105553-AAV9, titer: 3.3×1013vg/ml) and AAV1-Syn-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.7-1 μL of virus (AAV2-CMV-mCreb, 1×1012 Addgene Plasmid #68551 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1, Addgene), CAV-2 Cre (Titer ≥ 2.5×1011 pp ...
-
bioRxiv - Neuroscience 2024Quote: ... were injected a 1:1 mixture of pAAV.Syn.GCaMP6f.WPRE.SV40 (Addgene, stock #100837) virus and pAAV.CAG.LSL.tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Genomics 2020Quote: ... a total of 4 guides flanking the region to be deleted (2 on each side) were cloned into the pX459-v2 vector (Addgene #62988) (Ran et al. ...
-
bioRxiv - Molecular Biology 2021Quote: We performed a genome-wide CRISPR knock-out (KO) screen using the lentiviral Brie sgRNA library comprising 4 sgRNAs per protein-coding gene (Addgene #73632) (Doench et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... The patient-specific iPSCs were generated from LCLs by transfection with a combination of episomal plasmids (pCE-hOCT3/4, pCE-hSK, pCE-hUL, and pCE-mp53DD) (Addgene Inc.), as previously reported (Barrett et al ...
-
bioRxiv - Biophysics 2020Quote: ... A homozygous clone that passed all QC (U2OS HP1⍺ 4) was co-transfected with the transposon vector pEF1a-OsTIR-IRES-NEO-pA-T2BH (Addgene 127910) and SB100X in pCAG globin pA (Addgene 127909) ...
-
bioRxiv - Biochemistry 2022Quote: ... All plasmids generated by this study have been deposited to Addgene for distribution (See Supplemental Table 4 for Addgene accession numbers).
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells were transfected with 500 ng of equimolar pooled SCN1A_h1b sgRNAs (Table 4) and 500 ng dCas9p300Core (Addgene, plasmid #61357) using Lipofectamine 3000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 35 μl of hot glycerol was cooled to 4°C then 35 μl of the primer mixture and 25 μl of Tn5 (Addgene #112112) was added and mixed and held at 1 hr at RT with gentle pipet mixing every 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Retrovirus expressing NFAT1-GFP was constructed by inserting BglII/HpaI NFAT1-GFP fragment from HA-NFAT1(4-460)-GFP plasmid (Addgene #11107) into BglII/HpaI sites of pMSCV-Blasticidin plasmid (addgene #75085 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with 4 μg of corresponding transfer plasmid and 2 μg each of the four helper plasmids: pMDLg/pRRE (Addgene, #12251), pRSV/REV (Addgene ...