Labshake search
Citations for Addgene :
951 - 1000 of 1166 citations for Recombinant Human H1 Histone Family Member 0 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: The TR146 CRISPR genome-wide knockout library was generated using the Brunello human whole genome sgRNA library (Addgene, #73178) 18,54,55 ...
-
bioRxiv - Cancer Biology 2021Quote: Cas9-expressing stable cell lines were produced by infection with the lentivirus encoding human codon-optimized Streptococcus pyogenes Cas9 protein (LentiV_Cas9_puro, Addgene plasmid # 108100) and subsequent selection with 1 μg/mL puromycin ...
-
bioRxiv - Neuroscience 2021Quote: ... were infused bilaterally with AAV expressing the inhibitory designer receptor human M4 muscarinic receptor (hM4Di; AAV8-hSyn-hM4Di-mCherry, 4.8 × 1012 or 3.7 × 1012 vg/mL; Addgene; 0.3 μL) at a rate of 0.1 μL/min into the mOFC (AP ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Biochemistry 2022Quote: ... was made by ligating a PCR fragment encoding full-length human protein between ApaI and BamHI sites of pHis10-PS-SNAPf (75) (gift from Ron Vale; Addgene plasmid #78512 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vectors of the full-length SARS-CoV-2 spike and the human serine protease TMPRSS2 with a C-terminal C9-tag (TETSQVAPA) were acquired from AddGene (Summit Pharmaceutical International ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-CAGCGGAGCCCAGTAGATTC-3’ (exon19) (Raaijmakers et al., 2018) were cloned into the human codon optimised SpCas9 and chimeric guide expression plasmid (pX330, Addgene) using BbsI as previously described (Ran et al. ...
-
bioRxiv - Biophysics 2019Quote: Expression of N-terminally acetylated human αS and βS proteins was performed via co-expression with pNatB plasmid (Addgene #53613) in E ...
-
bioRxiv - Cell Biology 2020Quote: ... pLV-pEF1α-mNeonGreenPXN was generated by cloning of a sequence encoding human paxillin (PXN) from pmCherry Paxillin (a gift from Kenneth Yamada, Addgene plasmid #50526 ...
-
bioRxiv - Cell Biology 2021Quote: ... Source of different elements are as follows: LAMP1 signal peptide and human LAMP1 were PCR amplified from LAMP1-mGFP (Addgene Plasmid #34831 ...
-
bioRxiv - Biochemistry 2020Quote: ... and FMRP was purchased as a gene block from IDT. The human sequence (not optimized for E. coli) for FXR1P was purchased from Addgene. The genes coding for the human fragile X proteins (FMRP isoform 1 NCBI Reference Sequence ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Neuroscience 2021Quote: ... The GCaMP6s reporter was expressed in neurons under the human synapsin promoter following successful AAV transduction (AAV1-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA, AddGene). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: HEK-293T cells were transfected with the human PSD4 containing pLV lentivirus (VB160428-1095xdp – Vector Builder) together with the 3rd generation lentiviral packaging plasmid (Addgene): pMDLG/pRRE (Gag and Pol) ...
-
bioRxiv - Cancer Biology 2019Quote: Lentiviruses were prepared in human embryonic kidney 293T cells (ATCC) by triple transfection of the viral vector with psPAX2 + pMD.2G (Addgene) and transduced into MCF10A-5E ...
-
bioRxiv - Plant Biology 2020Quote: The human codon-optimized CAS9 with 2×35S CaMV promoter and Nos terminator was amplified from pAGM4723 plasmid (Addgene# 49772) using KpnI forward and PacI reverse primers (Supplemental Table 9) ...
-
bioRxiv - Neuroscience 2020Quote: ... P5-7 WT C57Bl/6 mice were used for the injection of AAV9 virus under human synapsin promoter (pAAV9.hSyn.iGluSnFR, commercially available from Addgene, USA) to drive transgenic expression of iGluSnFR in SGNs ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1 ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...
-
bioRxiv - Cancer Biology 2021Quote: Human H-RasG12V cDNA sequence was cloned into LeGO-iV2 and LeGO-iC2 bicistronic vectors (Addgene #27344 and #27345, respectively). Retroviruses were produced by JetPEI (Polypus-Transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments of 5’ and 3’ homology arms of ORACLE-OCT4 (exo) were replaced using human OCT4-2a-eGFP-PGK-Puro (#31938, Addgene) to target endogenous OCT4 locus with modification ...
-
bioRxiv - Molecular Biology 2020Quote: Human Drosha cDNA with a Flag-tag at the amino-terminus was cloned into pBABE-puro vector (Addgene plasmid#1764) for producing retrovirus of human Drosha wild type (WT) ...
-
bioRxiv - Neuroscience 2022Quote: ... The gRNAs targeting human AMPK α1 or α2 described previously were cloned into the gRNA/Cas9 expression vector pLenti-CRISPR v2 (Addgene) 91 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were immortalized by human telomerase gene (hTERT) using the retrovirus vector pLXSN-hTERT or the lentivirus vector pCLX-PGK-hTERT vector (#114315, Addgene). Retrovirus and lentivirus preparations ...
-
bioRxiv - Cancer Biology 2019Quote: ... The plasmid construct targeting exon 2 of human AIRE (AIREKO) was created using pSpCas9(BB)-2A-GFP (a gift from Dr. Feng Zhang, #48138, Addgene, http://n2t.net/addgene:48138 ...
-
bioRxiv - Neuroscience 2019Quote: ... The shRNA constructs to knockdown human DNMT3A1/3A2 and scrambled controls were hDNMT3A shRNA pSMP-DNMT3A1 and pSMP-Luc (a gift from George Daley, Addgene plasmid #36380 ...
-
bioRxiv - Cell Biology 2021Quote: ... and GFP-hRab31.dn3 (#1019) plasmids encoding GFP-labeled versions of the indicated human wild-type proteins were from Addgene (Cat# 49549 ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding human RTCB was cloned into the UC Berkeley MacroLab 4B vector (gift from Scott Gradia, Addgene plasmid #30115). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in Sf9 insect cells using the Bac-to-Bac Baculovirus expression system (Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... Pichia pastoris expression vector pPICZc carrying human β-actin fused with thymosin β4 and 6xHis-tag was a gift from Mohan Balasubramanian (Addgene #111146, RRID:Addgene_111146). β-Actin cDNA was mutated to introduce K50C and C374A for labeling with a cross-linking reagent ...
-
bioRxiv - Immunology 2020Quote: ... 1.5ugs of each hU6_sgRNAs and 3ugs a plasmid expressing human codon-optimised CAS9 driven by the CMV promotor (Addgene # 41815). 48 hours post transfection the media was changed for G418 selection media ...
-
bioRxiv - Microbiology 2021Quote: ... we cloned the human ACE2 cDNA sequence (NP_001358344.1) into a pLV-EF1a-IRES-Puro backbone vector (Addgene, cat no. 85132), and prepared lentiviral particles as described previously65 ...
-
bioRxiv - Genomics 2021Quote: Toronto human knockout pooled library (TKOv3) containing 71,090 based on a lentiCRISPRv2 backbone was a gift from Jason Moffat (Addgene #90294). The library was transformed and amplified using 25 μl Endura Competent Cells (Lucigen ...
-
bioRxiv - Genetics 2020Quote: Two pairs of gRNAs (Table S1 in “Supplementary file”) intermediated by human U6 (hU6) promoter were cloned after hU6 promoter of the plentiCRISPR_V2 plasmid (Addgene, #52961), according to Vidigal et al.’s protocol 34 ...
-
bioRxiv - Cell Biology 2022Quote: ... BirA-ACLY constructs were generated by inserting human ACLY into pcDNA3.1 mycBioID vector (N-terminal MYC-BirA, Addgene, plasmid 35700) with a 16 or 46 amino acid linkers between ACLY and BirA ...
-
bioRxiv - Biophysics 2022Quote: ... and 32C (residues 172–270 of RPA2) domains of human RPA were PCR amplified using p11d-tRPA plasmid (Addgene plasmid102613) (Henricksen et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMSCV-p19Ink4d-IRES-GFP plasmid expressing mouse p19INK4d (sharing 87% sequence identity with human p19INK4d) (61) was obtained from Addgene.
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a plasmid expressing human Ago2 fused to GFP in the N-terminal region of Ago2 was obtained from Addgene (11590). For recombinant protein purification ...
-
bioRxiv - Neuroscience 2022Quote: ... and fused in frame without a linker to human H2B (H2BC11) (accession #NM_021058) and cloned into the pAAV-CAG-tdTomato (Addgene #59462) using the sites KpnI and EcoRI at the 5 and 3 prime end respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... An AAV8 encoding the inhibitory designer receptor KORD fused to the fluorescent protein mCitrine under the control of the human synapsin promoter in a Cre-dependent manner was obtained from Addgene (AAV8-hSyn-dF-HA-KORD-IRES-mCitrine ...
-
bioRxiv - Neuroscience 2023Quote: ... encoding the Cre enzyme fused to the green fluorescent protein (GFP) under the control of the human synapsin promoter was obtained from Addgene (AAVrg.hSyn.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Microbiology 2022Quote: ... The Jun-Nt VFP (Jun) and Fos-Ct VFP (Fos) and the human ACE2 and TMPRSS2 expressing plasmids were obtained from Addgene (#22012 ...
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Neuroscience 2022Quote: Full length human TAOK1 was obtained from Transomics Technologies in PCR-XL-Topo plasmid and inserted into sfGFP-C1 (Plasmid #54579, Addgene), using the EcoRI and MfeI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... 250nl of an anterograde adeno-associated virus (AAV) vector expressing a green fluorescent protein under the hSyn (human synapsin) promoter (AAV5-hSyn-eGFP; Addgene) was injected into ACC to fluorescently mark the anatomical boundary of the claustrum (White et al. ...
-
bioRxiv - Cancer Biology 2024Quote: The chimeric antigen receptor against human CD276 (Du et al., 2019) and CD19 (Maude et al., 2018)together with the Thy1.1 surface antigen (Addgene 154194)(Umkehrer et al. ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Genetics 2024Quote: The IS621 recombinase gene was human codon optimized and cloned into a modified pFastBac expression vector (Addgene, Item ID: 30115), which includes an N-terminal His6-tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...