Labshake search
Citations for Addgene :
951 - 1000 of 1354 citations for Recombinant Human BTN3A1 Protein Fc Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat sequences (PguCas13b ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat sequences (PguCas13b ...
-
bioRxiv - Bioengineering 2021Quote: ... were PCR amplified from PmCDA1-1x uracil-DNA glycosylase inhibitor protein (UGI) (Addgene #79620), evoCDA1 pBT277 (Addgene #122608) ...
-
bioRxiv - Microbiology 2021Quote: The Plasmid expressing SARS CoV-2 Spike protein (Wuhan isolate) was procured from Addgene with 19 nineteen amino acids deletion at C- terminal that enables efficient lentiviral packaging ...
-
bioRxiv - Biophysics 2020Quote: The plasmid for membrane scaffold protein was MSP1D1 in pET28a was purchased from Addgene and prepared as previously described (Hagn et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Immunology 2020Quote: ... and VSV-G protein-encoding plasmid pMD2.G were obtained from Addgene (Watertown, MA).
-
bioRxiv - Developmental Biology 2019Quote: ... RNPs of Cas9 protein (Cas9-mCherry, pMJ293 (Burger et al., 2016) (available from Addgene)) and sgRNA were in vitro-assembled for 10 min at 37°C in 300 mM KCl to ensure maximum cleavage efficiency and microinjected into the cell of one-cell stage embryos (Burger et al. ...
-
bioRxiv - Bioengineering 2021Quote: ... The Spike protein from pcDNA3.1-SARS2-Spike was a gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Microbiology 2021Quote: ... A VSV G protein expression plasmid was obtained from Addgene (Watertown, MA; Cat.# 8454).
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST I-B system’s proteins and inverted repeat constructs were sub-cloned from Addgene plasmids #168137 and #168146 to generate pIF1003.
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid YFP-SRI was generated by sub-cloning human sorcin cDNA taken from pAd-hSRI (22) into KpnI-ApaI sites of mVenusC1 (Addgene #27794).
-
bioRxiv - Molecular Biology 2020Quote: FLAG-mEm-WT Tau and FLAG-mEm-Tau K174Q sequences were cloned into pAAV2 vector under human synapsin promoter (Addgene, #50465). Adenoviral particles were used to infect a primary hippocampal culture.
-
bioRxiv - Molecular Biology 2021Quote: ... similar to how we previously generated the human cell expression constructs for AcrIIA4 and AcrIIA5 (Addgene IDs 133801 and 133802, respectively) (see Supplementary Sequences) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Δ50 were PCR amplified from human templates using forward (fwd) primer 1593 and reverse (rev) primer 1651 and inserted into mycBioID2 pBabe puro (Addgene #80901) cut EcoRI to PmeI ...
-
bioRxiv - Genetics 2019Quote: sgRNAs targeting human ADCK4 (sgRNA1: GCTGCACAATCCGCTCGGCAT, sgRNA2: GTAAGGTCTGCACAATCCGCT, and sgRNA3: GACCTTATGTACAGTTCGAG,) were cloned into BsmBI-digested lentiCRISPR v2 (Addgene plasmid #52961). ADCK4 cDNA was cloned into the p3xFLAG CMV26 (C-terminal ...
-
bioRxiv - Neuroscience 2020Quote: ... was cloned into a rAAV vector under the human synapsin promoter using the plasmid pAAV-hSyn-EGFP (gift from Bryan Roth; Addgene, #50465) as backbone and removing EGFP ...
-
bioRxiv - Neuroscience 2020Quote: UAS-SMARCA1 construct: Flies carrying UAS-SMARCA1WT were generated using human SMARCA1 cloned into the pFastBac Dual vector (Addgene plasmid #102243). Gateway cloning (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Cell Biology 2021Quote: ... The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene; plasmid #30116). All constructs were confirmed by sequencing.
-
bioRxiv - Neuroscience 2020Quote: ... with a pEGFP-C1 mammalian vector containing full length human A53T variant αSyn with a fusion EGFP tag (Addgene, Plasmid #40823), following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Biochemistry 2020Quote: Human ATAD2/B cDNA (UniProt codes Q9ULIO and Q6PL18) was a gift from Nicole Burgess-Brown (Addgene plasmid # 38916 and 39046)7 ...
-
bioRxiv - Microbiology 2020Quote: ... A CRISPR/Cas9 lentiviral vector against human-β2 microglobulin was constructed by cloning an expression cassette for both Cas9 and guide RNA (gRNA) of PX458 (Addgene #48138) into the FG12 vector ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequence for human Dia1 was purchased from GeneScript and cloned in eBFP2-N1 backbone vector (gift from Michael Davidson, Addgene #54595) using XhoI/Kpn1 double digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells seeded to 150mm dishes were transfected with 21 μg of the human gRNA pooled library in lentiGuide-Puro (Addgene #1000000049), 15.75 μg of pSPAX2 and 5.25 μg of pVSV-G plasmids ...
-
bioRxiv - Biochemistry 2022Quote: ... Full-length human KRAS4B G12C was ectopically expressed from the retroviral expression vector pBABE containing an N-terminal HA-tag (Addgene #58901). Viral particles were generated by transient transfection of each expression vector into HEK 293T cells using Fugene6 (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were then infected with an inducible Tet-ON lentivirus carrying the human PLK1 cDNA (pLenti CMVtight Hygro DEST from Addgene #26433) and selected with hygromycin (350 µg/ml) ...
-
bioRxiv - Cancer Biology 2022Quote: ... carrying the human CRISPR KO pooled library Brunello in a lentiGuide-Puro backbone (gift from David Root and John Doench; Addgene #73178) to a final volume of 2 mL with 4 µg/mL polybrene ...
-
bioRxiv - Immunology 2020Quote: ... Human orfeome clone 10217) was gateway cloned into an attR-destination vector encoding an N-terminal FLAG tag (Addgene, Plasmid #18700), with the Gateway™ LR Clonase™ II Enzyme mix (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Microbiology 2021Quote: ... The oligos of CRISPRa library were synthesized in Synbio Technologies according to the Human Genome-wide CRISPRa-v2 Libraries (Addgene, 83978) (30).
-
bioRxiv - Neuroscience 2020Quote: ... TH-Cre hPSC cells (passage were transduced with a lentiviral construct under control of the human TH-Cre promoter (Addgene, plasmid # …..). The cells were transduced at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used the Gateway recombination system to introduce the following Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into pHAGE-TRE-DEST-NBioTAP (Addgene #53568) and pHAGE-TRE-DEST-CBioTAP lentiviral vectors (Addgene #53569) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human N-WASP GBD domain was PCR amplified from pCS2-mRFP-GBD (a kind gift from William Bement, Addgene plasmid 26733) with XhoI/AscI flanking restriction sites and cloned into pET-pmKate2 to generate mKate-GBD ...
-
bioRxiv - Immunology 2020Quote: ... Human G3BP1 cDNAs with or without stop codon were amplified by PCR from pN1/G3BP1-iRFP (Okada lab plasmids, Addgene #129339) with the sense primer 5′ -GCCAGATCTATGGTGATGGAGAAGCCTAG-3′ and the antisense primers 5′ -GCCGAATTCGGATCCTTACTGCCGTGGCGC-3′ or 5′ -GCCGAATTCGGATCCCTGCCGTGGCGCAAG-3′ ...
-
bioRxiv - Cell Biology 2021Quote: ... CFP-hRab5C(S35N).dn3 (#1006) encoding Cerulean-labeled dominant negative mutant version of human Rab5C isoform was from Addgene (Cat# 11504). GFP-hEEA1 (#970 ...
-
bioRxiv - Neuroscience 2020Quote: ... the insert consisting of GtACR2-ts-mCerulean3-βHK-Chrimson was cloned into an AAV2-backbone behind a human synapsin (hSyn) promoter (pAAV-hSyn-BiPOLES-mCerulean; Addgene #154944). A soma-targeted ...
-
bioRxiv - Genetics 2021Quote: ... were placed downstream of the human U6 promoter in the pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro backbone (Addgene, #71236). The guide RNA sequences were:
-
bioRxiv - Molecular Biology 2020Quote: ... and RPL22-3xHA (primers JG106/109; human cDNA template) with EcoRI/PstI digested pLV-TetO-hNGN2-P2A-eGFP-T2A-Puro (Addgene #79823) backbone ...
-
bioRxiv - Immunology 2021Quote: ... A549ACE2 cells were generated using lentiviral transduction of a human ACE2 cDNA expressing plasmid (backbone: pLV-EF1a-IRES-Puro (Addgene 85132) as previously described [31] ...
-
bioRxiv - Cell Biology 2021Quote: ... a codon-optimized signal sequence from human ER-resident p23 was inserted into the AgeI site of p-sfGFP-N1 (Addgene #54737). p23ss-sfGFP lacking the stop codon was PCR amplified and flanked with a 3’ NheI site and TA cloned into pCRII-TOPO vector ...