Labshake search
Citations for Addgene :
951 - 1000 of 2145 citations for Osteopontin Human OPN ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... annealed and cloned into pLKO.1 at EcoRI and AgeI restriction sites as per the pLKO.1 protocol from Addgene. The resultant plasmids were transformed in DH5α cells for amplification and isolated ...
-
bioRxiv - Immunology 2020Quote: ... and the full-length protein (IFT20, aa 1-132) in-frame with the tags into the pEGFP-N1 (#6085-1 Addgene) and pGEX-6P-2 vectors (#27-4598-01Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a 1:1 combination of AAV8-CaMKIIα-GFP-Cre (UNC) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Cat. #44362, Addgene).
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with 0.5 µg of either a 1:1 mixture of the S plasmids and a Jun-Nt Venus fragment (Addgene 22012) plasmid or a mixture of hACE2 plasmid (kindly provided by Dr ...
-
bioRxiv - Biochemistry 2024Quote: ... The Venus-PDZ1 (ZO-1) was generated by site directed mutagenesis of the Venus-ZO-1 expression vector (Addgene: 56394) using primer pairs that delete the entire ZO-1 coding sequence except for the first PDZ1 domain ...
-
bioRxiv - Neuroscience 2021Quote: ... The pLKO.1-TRC cloning vector (RRID: Addgene_10878) and the pLKO.1-sh-Ctl (RRID ...
-
bioRxiv - Neuroscience 2021Quote: ... and the pLKO.1-sh-Ctl (RRID: Addgene_10879) were kindly provided by Marian Martínez-Balbás ...
-
bioRxiv - Cell Biology 2021Quote: ... to either pLKO.1 puro (Addgene Plasmid #8453) for constitutive knockdown or Tet-pLKO-puro (Addgene Plasmid #21915 ...
-
bioRxiv - Genetics 2021Quote: ... and 1 μg CMV-SB10 (Addgene plasmid # 24551) via the tail vein in 5-7 s ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μg pCAGGS-mCherry (Addgene, plasmid #41583) (45) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Using 1 ng pCFD6 (Addgene, Cat. No: 73915) as template ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μL of LSL-tdTomato (Addgene#: 100048); 2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmid pIRES2-eGFP (Addgene, Cat#6029-1) was used as transfection control ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCAFNF-tdTomato (Addgene#125575, 1 μg/μL) were used ...
-
bioRxiv - Microbiology 2020Quote: ... and pcDNA3.1-V5-hMcl-1 (Addgene plasmid #25375) were purchased from Addgene (Cambridge ...
-
bioRxiv - Genomics 2021Quote: ... and 1 µg of pMD2.G (Addgene, 12259) lentivirus packaging plasmids into 8 million HEK293T cells in a 10-cm dish with PolyJet (SignaGen Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 μg pMD2.G (Addgene plasmid, 12259) combined with the overexpression vectors H2B-cherry ...
-
bioRxiv - Cell Biology 2022Quote: ... together with 1 μg pVSV-G (#138479, Addgene) and 2 μg psPAX2 (#12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... HSV-1 UL12.5 was purchased from Addgene (#70109) and the EGFP was removed by subcloning ...
-
bioRxiv - Immunology 2022Quote: ... then ligated into pLKO.1 vector (Addgene #10878) using AgeI/EcoRI ...
-
bioRxiv - Microbiology 2022Quote: ... and pLVX or pLKO.1 transfer plasmids (Addgene) using jetOPTIMUS according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we inserted shRNA sequences into pLKO.1 (Addgene) or shmirRNA (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF5C(1-560)-2xmCh-EF(C) (Addgene #61664) and KIF5C(1-560)-mCit (Addgene #61676 ...
-
bioRxiv - Genetics 2023Quote: ... anti-Na/K-ATPase (1:1000, Addgene #180089) (membrane protein loading control) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral cloning vector pLKO.1-TRC (Addgene, #10878) was used for shRNA expression ...
-
bioRxiv - Genomics 2023Quote: ... and 1 μg of pMD2.G (Addgene, 12259) packaging plasmids were cotransfected into 8 million HEK293T cells in a 10-cm dish supplemented with 36 μl PolyJet (SignaGen Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and the pLKO.1 plasmid (Addgene, Cambridge, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Cell Biology 2023Quote: ... For lentiviral transfections 1 μg VSVG (Addgene #8454) and 1.86 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Genetics 2024Quote: ... mixed with 1 μg of PsPax2 (Addgene # 12260), 1 μg of the lentiviral transfer vector G1088E_pLenti-CMV-mNeonGreen-2A-HygroR (Addgene #216279) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Cancer Biology 2020Quote: ... KIT D816V ESCs were generated as described previously using the pX335 vector (Addgene 42335) and oligonucleotides listed in supplemental Table 3.29
-
bioRxiv - Cancer Biology 2022Quote: ... Luciferase/tdTomatao reporter was engineered using the MuLE system kit from Addgene (Cat. # 1000000060) (54).
-
bioRxiv - Neuroscience 2021Quote: ... was mixed 1:1 with the retrogradely trafficked AAV encoding eGFP (AAVrg-hsyn-EGFP, 7.4 × 1012 vg/mL; Addgene, Watertown, MA) and infused into the BLA (AP ...
-
bioRxiv - Neuroscience 2021Quote: 50 nL of AAV1 particles (titer 1 × 1012 cfu mL−1) produced from pAAV-EF1a-double-floxed-hChR2(H134)-EYFP-WPRE-HGHpA (Addgene.org #20298) was injected into L5 of S1 (co-ordinates from bregma ...
-
bioRxiv - Neuroscience 2021Quote: 50 nl of AAV1 particles (titer 1 × 1012 cfu ml−1) produced from pAAV-EF1a-double-floxed-hChR2(H134)-EYFP-WPRE-HGHpA (Addgene #20298) was injected unilaterally into the L5 of S1 (coordinates from bregma ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN glia AAV-5: pZac2.1 gfaABC1D-cyto-GCaMP6f at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN neurons - AAV-9: pGP-AAV-syn-GCaMP6s-WPRE.4.641 at a titre of 1×1013 GC·ml- 1 (Addgene, Watertown, MA, USA);
-
bioRxiv - Developmental Biology 2021Quote: ... plasmid was created by Infusion cloning of CMV-GFP(1-10) from pcDNA3.1-GFP(1-10) (a gift from Bo Huang (Addgene plasmid # 70219) into a pUC57 backbone ...
-
bioRxiv - Biophysics 2020Quote: ... 1 µg of HRD plasmid and 1 µg of AAVS1 T2 CRISPR plasmid (a gift from Masato Kanemaki, Addgene plasmid #72833) were transfected into U2OS cells using FuGENE HD (Promega ...
-
bioRxiv - Microbiology 2021Quote: Chemical-genetic screens were initiated by thawing 5 × 1 mL (1 OD600 unit per mL) aliquots of the Mtb CRISPRi library (RLC12; Addgene #163954) and inoculating each aliquot into 19 mL 7H9 supplemented with kanamycin (10 μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... and YTHDC1 were generated by cloning the shRNA (RNAi Consortium shRNA Library) from pLKO.1-puro into the pLKO.1-blast backbone (Addgene #26655).
-
bioRxiv - Molecular Biology 2020Quote: ... pCGN-ATF6 (1-373) and pCGN-ATF6 (1-373) m1 were gifts from Professor Ron Prywes (Addgene plasmid 11974, 27173, 27174).