Labshake search
Citations for Addgene :
951 - 1000 of 1349 citations for N Nitrosodiphenylamine 2 2 4 4 6 6 D6 96% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... a 50:50 mix of AAV8-CamKII-mCherry (Neurophotonics, Laval University, Quebec City, Canada, Lot #820, titre 2×1013 GC/ml) and AAVrg-CAG-GFP (Addgene, Watertown ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Physiology 2023Quote: ... sgRNA primers were (Table 2) cloned into BbsI-HF linearized pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene, Plasmid Cat. #64324) or pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Biophysics 2023Quote: ... cells transfected with pcDNA3.1-mGL-picALuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Biophysics 2023Quote: ... RRID:Addgene_141370)72 or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: A 2.2 kb BamHI-SalI cDNA fragment of the long form of human PREPL (PREPLL) was cloned into pLenti-GFP (Addgene) digested with the same restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... the resistance cassette flanked by LoxP sites (Sec16) was excised by transfection of 2 µg of pBS598 EF1alpha-EGFPcre plasmid (plasmid #11923; Addgene) that encodes for cre recombinase.
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Supplementary Table 2) into the BbsI restriction sites of the pX459 vector (#62988, Addgene). An empty pX459 vector was used to generate matching control cell lines ...
-
bioRxiv - Biophysics 2023Quote: ... and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids encoding spikes of SARS-CoV-2 variants Delta (Cat. No. 172320) and Omicron (Cat. No. 179907) were procured from Addgene, USA.
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Biochemistry 2024Quote: ... expressing Cas9 nuclease and two gRNAs (see below for sequences) together with the CRIS-PITCh vector pX330S-2-PITCh (63670, Addgene), harboring the Lamin A microhomologies and GFP-Puro or GFP-Neo/Kan insertions ...
-
bioRxiv - Developmental Biology 2021Quote: ... N-terminal KRAB-dCas9 (a gift from Bruce Conklin, Addgene plasmid # 73498) fused with a destabilising domain ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... pEGFP-N-Drd1 plasmid was a gift from Kirk Mykytyn (Addgene, 104358), GFP-DRD2 plasmid was a gift from Jean-Michel Arrang (Addgene ...
-
bioRxiv - Biochemistry 2019Quote: ... coli Destination vector pDest-566 (N-terminal His6-MBP tag, Addgene #11517). Final baculovirus expression clones were transformed into DH10Bac cells (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry-SiT-N-15 plasmid was a gift from Michael Davidson (Addgene plasmid # 55133 ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Cell Biology 2019Quote: ... and mEmerald-IFT88-N-18 was a gift from Michael Davidson (Addgene plasmid # 54125 ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Neuroscience 2019Quote: ... an eGFP-only reporter without DREADDs (n=7; Addgene: AAV2-hSyn-eGFP), was employed in a group of control rats [65–67].
-
bioRxiv - Cancer Biology 2021Quote: ... and pcDNA3-RLUC-POLIRES-FLUC (a gift from N. Sonenberg; Addgene #45642) (Poulin et al. ...
-
bioRxiv - Microbiology 2020Quote: ... pCAG-VSV-N (#64087) and pCAGGS-T7Opt (#65974) were ordered from Addgene. S expressing pCAGGS vectors were used for the production of pseudoviruses ...
-
bioRxiv - Immunology 2022Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Cancer Biology 2022Quote: ... FRA1 sequence from p6599 MSCV-IP N-HAonly FOSL1 vector (Addgene, 34897) was cloned into pLV-EF1α-IRES-puro vector (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... the SMARCAL1 coding sequence was cloned into pLEX_305-N-dTAG (Addgene #91797) by the Gateway system (Life Technologies/Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid pKAN-PCUP1-9myc-AID*(N) from Addgene (Morawska and Ulrich, 2013), and plasmid pGIK43 from Georgios Karras.
-
bioRxiv - Developmental Biology 2021Quote: ... two guideRNAs were designed to flank the target exon coding the β1-2 loop (see Table EV1 for primer sequences) and cloned into the guide RNA expression pCFD4 vector (Addgene #49411). The exon of interest and homology arms were cloned into donor template plasmid pHD-ScarlessDsRed (Addgene # 64703 ...
-
bioRxiv - Molecular Biology 2021Quote: ... four different gRNA sequences (see Table 2 for sequences; Fig. S3A) were multiplexed into a Cas9-nickase backbone (Addgene plasmid 48140) as previously described [64] ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) with 8xHis tag was obtained from Addgene (#145145). The mammalian expression vector for soluble ACE2 pcDNA3-sACE2 (WT)-sfGFP (#145171 ...
-
bioRxiv - Neuroscience 2019Quote: ... We cloned a variant of GCaMP6f fused with a localisation signal targeting synaptic terminals22 (SyGCaMP6f) and packaged it into an AAV2/2 vector (Addgene, 51085). This virus restricted GCaMP expression to boutons12 ...
-
bioRxiv - Cell Biology 2019Quote: ... Two gRNA sequences targeting different regions of linc00899 (guide 1 and 2) were cloned into pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955). All clones were verified by Sanger sequencing using mU6 forward primers (Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Injection mix consisted of 0.5pmol/ul in vitro transcribed RNA and 2.5ng/ul co-injection marker (pmyo-2::mCherry::unc-54 3’UTR) plasmid pCFJ90 (Addgene, plasmid #19327), dissolved in water ...
-
bioRxiv - Cancer Biology 2020Quote: V7 and V8 barcoding lentiviral transfer plasmids used for guide RNA array screening were constructed in 2-part Gibson assemblies using pLJM1-EGFP (Addgene #19319)53 backbone digested with EcoRI + gene blocks for V7 or V8 barcodes to make pLJM1-EGFP-V7 and pLJM1-EGFP-V8.
-
bioRxiv - Cancer Biology 2021Quote: Lentiviruses made from pLentiCRISPRv.2 were produced by co-transfection of the lentiviral backbone constructs and packaging plasmids pSPAX2 (Addgene 12260) and pMD2.G (Addgene 12259) ...
-
bioRxiv - Biochemistry 2021Quote: Spike display plasmids incorporate the pre-fusion stabilized SARS-CoV-2 S-6P (“HexaPro”) as the reference sequence for all spike variants (Addgene #154754)38 ...
-
bioRxiv - Bioengineering 2021Quote: ... by introducing 75 nt of the SARS-CoV-2 Leader sequence into the NheI-digested EFS-EGFPd2PEST-2A-Hygro plasmid (Addgene 138152). We inserted the TRS-Leader immediately before the coding sequence by ligation of annealed oligos (see Supplementary Table 3 for sequences) ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...