Labshake search
Citations for Addgene :
951 - 1000 of 1016 citations for 7 Benzyl 2 7 Diazaspiro 3.5 nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp14 was subcloned into a modified pBIG1a vector containing a pLIB-derived polyhedrin expression cassette to either contain an N-terminal 3xFlag-6His tag (sequence: MDYKDHDGDYKDHDIDYKDDDDKGSHHHHHHSAVLQ-nsp14) or no tag to generate SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164). Baculoviruses were generated and amplified in Sf9 insect cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Plant Biology 2021Quote: ... pICH47811-pTCSn::nls:tGFP (position 2) was cloned together with pICH47802-pIPT3::nls:tdTOMATO::t35S (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014).
-
bioRxiv - Cell Biology 2021Quote: ... LifeAct mScarlet cell lines were generated by electroporating 2 μg/ml of pLifeAct-mScarlet-N1 plasmid DNA (a gift from Dorus Gadella, Addgene plasmid 85054) into WT and CD56-KO NK92 cells using the Amaxa nucleofector (Kit R ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6J mice received unilateral injections of AAVrg-CaMKIIα-mCherry (200 nl at 200 nl/min, titer 2×1013 vg/ml, #114469-AAVrg, Addgene, MA, USA) into the right main OB (0.5 mm lateral from midline ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cell Biology 2022Quote: ... INS-1 832/3 EV or g1-2 SNAP-GLP-1R cells were transfected with the pCI HA NEDD4 construct (a gift from Prof. Joan Massague, Addgene plasmid #27002) 24 hours before the experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The S1R-Apex and GFP-Apex plasmids were co-transfected into either HeLa cells (ATCC; CCL-2) or HEK293T cells (ATCC; CRL-3216) along with pXAT2 (Addgene plasmid 80494) (30) ...
-
bioRxiv - Immunology 2020Quote: ... the lentiCas9-v2 lentivirus were produced from HEK-293FT cells transfected with the lentiCas9-v2 plasmid mixed at a 2:1:1 DNA ratio of the lentiviral packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Systems Biology 2020Quote: ... Cells were transformed by standard lithium acetate methods to fluorescently labelled indicated organelles with monomeric Kusibara Orange 2 (mKO2) obtained from Addgene (Cambridge, MA). Peroxisomes in strains engineered with deletions of DNM1 ...
-
bioRxiv - Biochemistry 2021Quote: ... Templates used to create the PCR fragments were pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (gift from Nevan Krogan; Addgene plasmid #141382), pCEP4-myc-ACE2 (gift from Erik Procko ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles were produced in HEK293 cells after transient transfection of the packaging vectors psPAX.2 and pMD.G2 (Addgene #12260 and #12259). After viral transduction ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Microbiology 2023Quote: The ISRE-Luc reporter plasmid (32) (25 ng) was either transfected alone or co-transfected with a plasmid expressing SARS-CoV-2 genes NSP13 (Addgene, cat. 141379) (25 ng) ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Cell Biology 2023Quote: Two small gRNA (#1-GGGGTATTTCAATCAGAAGC; #2-ACGGGAAGCGCACAGTTTAT) targeting msps genomic region were synthesized and inserted into the pCFD5 vector (74) (Addgene, Plasmid #73914) via BbsI digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Topbp1 (shTopbp1 #1 and shTopbp1 #2) and a scramble control sequence (shScbl) were cloned into the pLKO.1-Hygro lentiviral vector (Addgene plasmid #24150). The lentiviral-containing medium was harvested from HEK293T cells at 48 h and 72 h after transfection ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were seeded at 80% density in a 10-cm tissue cell culture treated dish and transfected with the 6 µg of expression plasmid and packaging plasmids 2 µg of pMD2.G (Addgene, cat# 12259) and 4 µg of psPAX2 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9; http://n2t.net.addgene:20298; RRID; Addgene:20298, gift from Karl Deisseroth); Fig 4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Pipettes were front-filled with AAV (serotype 2/1) expressing either CAG-FLEX-GFP (UPenn, lot# V0827) or pCAG-FLEX-tdTomato-WPRE (Addgene cat# 51503). 3 min after reaching the target ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into two model DARPins: 1) 3G124 (anti-GFP) and 2) and Off7 (anti-MBP) and cloned into a pET vector (Addgene plasmid #29666) containing a N-terminal His-Tag ...
-
bioRxiv - Neuroscience 2024Quote: The following AAV vectors were used for channelrhodopsin-2 expression: pAAV-EF1a-double floxed-hChR2 (H134R)-EYFP-WPRE-HGHpA (Addgene plasmid #20298), pAAV-EF1a-double floxed-hChR2 (H134R)-mCherry-WPRE-HGHpA (Addgene plasmid #20297) ...
-
bioRxiv - Neuroscience 2024Quote: ... was used to inject a total of 800 nL of a 2:18 mixture of AAV-syn-jGCaMP7s-WPRE (Addgene: 104487-AAV1) and AAV-syn-FLEX-rc[ChrimsonR-tdTomato] (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... These cells were then transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (CAG-GFP-IRES-CRE was a gift from Fred Gage, Addgene plasmid # 48201) 52 ...
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... with AgeI and BstBI restriction sites into the pLenti CMV/TO GFP-MDC1 (779-2) (plasmid #26285, Addgene, gift from E. Campeau; Genewiz) backbone ...
-
bioRxiv - Genomics 2019Quote: ... We co-transfected the pLentiRNACRISPR constructs together with a GFP expression plasmid in a 2:1 molar ratio. The guide RNA length comparison (Supplementary Fig. 1d) was done using previously published RfxCas13d constructs (Addgene 109049 and 109053), except that we removed the GFP cassette from the RfxCas13d plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Cancer Biology 2020Quote: pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines were obtained upon transfection of the SAOS 2 cell line with the plasmids pBABE-puro or pBABE-puro-hTERT from Addgene (#1764, #1771, respectively), and Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines presented in this study are available from the corresponding author upon request and all plasmids are available from Addgene (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned from pLVX- EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro and pLVX-EF1alpha-SARS-CoV-2-E-2xStrep- IRES-Puro (kind gifts from Nevan Krogan, available from Addgene #141386 and #141385) using PCR to remove the 2xStrep epitope tag ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660), the lentiviral expression plasmid ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...