Labshake search
Citations for Addgene :
951 - 1000 of 3548 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 293T cells were transfected with 2 μg of pMD2.G (Addgene, 12259), 4 μg of psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... pDONR207 SARS-CoV-2 nsp1 Delta RC (M1, K164A/H165A, Addgene #164522) and pDONR207 SARS-CoV-2 nsp1 R124A/K125A (M2 ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... and 2 µg of the envelope plasmid (pMD2.G / VSVG, Addgene #12259) per well were co-transfected using PEI as described above ...
-
bioRxiv - Molecular Biology 2024Quote: Using the 3XFlag-pA-Tn5-Fl expression vector[2] (Addgene plasmid #124601), protein A sequence was replaced with an anti-GFP nanobody sequence that was PCR amplified from the pGEX6P1-GFP-Nanobody vector [30] (Addgene plasmid #61838 ...
-
bioRxiv - Genetics 2024Quote: ... was constructed by replacing the dU6:2 promoter from pLib6.4 (Addgene #133783) with the dU6:3 promoter from pCFD3 (Addgene #49410 ...
-
bioRxiv - Cell Biology 2024Quote: ... COS-7 cells were transfected with 1 μg of transferrin receptor mCherry-TFR-20 (Addgene, 55144) using Lipofectamine LTX (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... pICH47811-pTCSn::nls:tGFP (position 2) was cloned together with pICH47802-pIPT3::nls:tdTOMATO::t35S (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014).
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9; http://n2t.net.addgene:20298; RRID; Addgene:20298, gift from Karl Deisseroth); Fig 4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Pipettes were front-filled with AAV (serotype 2/1) expressing either CAG-FLEX-GFP (UPenn, lot# V0827) or pCAG-FLEX-tdTomato-WPRE (Addgene cat# 51503). 3 min after reaching the target ...
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into two model DARPins: 1) 3G124 (anti-GFP) and 2) and Off7 (anti-MBP) and cloned into a pET vector (Addgene plasmid #29666) containing a N-terminal His-Tag ...
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Two small gRNA (#1-GGGGTATTTCAATCAGAAGC; #2-ACGGGAAGCGCACAGTTTAT) targeting msps genomic region were synthesized and inserted into the pCFD5 vector (74) (Addgene, Plasmid #73914) via BbsI digestion ...
-
bioRxiv - Immunology 2024Quote: ... Trpv1-Cre mice were intraperitoneally injected on postnatal day 1 with 10uL of 2×1011 genome copies/mL AAV9-FLEX-tdTomato (Addgene, 8306-AAV9) then sacrificed for lung harvest at 6-8 weeks old ...
-
bioRxiv - Molecular Biology 2023Quote: ... After an incubation of 1h at room temperature with a pA-Tn5 adapter complex (Addgene #124601), the Tn5 enzyme tagmentation reaction was performed by adding a buffer containing MgCl2 to the samples and incubating for 1h at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid mEGFP- lifeact-7 (Addgene # 54610) was a gift from Michael Davidson and Lamp1-mGFP (Addgene # 34831 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid #54560) were gifted by Michael Davidson ...
-
bioRxiv - Cell Biology 2021Quote: ... 7 and 8 were ordered from Addgene. The plasmids ordered were HDAC2 Flag (Addgene plasmid # 36829 ...
-
bioRxiv - Cell Biology 2021Quote: ... and td-Tomato-LifeAct 7 (Addgene 54528).
-
bioRxiv - Microbiology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid#54560) were gifted by Michael Davidson ...
-
bioRxiv - Microbiology 2022Quote: ... 7 μg of pMD2.G (Addgene # 12259), and 11 μg of pMDLg/pRRE (Addgene # 12251 ...
-
bioRxiv - Cell Biology 2023Quote: ... and mTagBFP2-Lifeact-7 (Addgene plasmid #54602)69 from Dr ...
-
bioRxiv - Bioengineering 2024Quote: ... and mCherry-Rab11a-7 (Addgene plasmid # 55124) were gifts from Michael Davidson ...
-
bioRxiv - Immunology 2024Quote: ... Anti-CD19 scFv amino acid sequence was obtained from Addgene plasmid #79125 ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: pUltra-U6-crRNAs-U6-tracr was constructed in a 3-part Gibson assembly using PacI linearized pUltra (Addgene #24129)54 backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA encoding mEos3.2-paxillin was generated by replacing the cDNA encoding mGFP in the mGFP-paxillin plasmid with that encoding mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PTEN or non-targeting-control (see Table 3) were cloned into pLKV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene ID:67974) and Cas9 expressing cell lines were transduced and selected with puromycin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR and products were cloned into NheI and EcoRV restriction sites (Table 3: marked with blue) of pcDNA3.1-hygro vector (Addgene, kindly provided by Mark Richards-Bayliss group ...
-
bioRxiv - Genomics 2021Quote: ... we performed 80 co-transfections of HeK293T virus packaging cells (at approximatelly 60-70% confluence on 10 cm dishes) with 3 μg of the pDECKO_mCherry plasmid library and 2.25 μg of the packaging plasmid pVsVg (Addgene 8484) and 750 ng of psPAX2 (Addgene 12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... a lenti-viral backbone containing a UCOE-EF-1α promoter and a 3’ WPRE element was used (Addgene #135448), which was a kind gift of Martin Kampmann and Jonathan Weissman ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and Flailer primary neuronal cultures were infected at 3 DIV with AAV coding for GCaMP6s (Addgene #51086) and FL1 or control AAVs ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4T1 and EMT6.5 cancer cells were transfected with the mammalian expression lentiviral vector pLKO.3 Thy1.1 (Addgene plasmid #14749) containing the surface protein Thy1.1 as a reporter protein ...
-
bioRxiv - Cell Biology 2022Quote: ... the full-length dFz2 ORF was amplified and then mScarlet-I was fused to its 3’ end (Addgene #85044). The dFz2-Scarlet fusiomn was then cloned into the UASp vector ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3.7 μg pLenti6.3-HA-NL-tetraspanin plasmids or pLenti6.3-CD63-pHluorin plasmid were co-transfected with 0.9 μg pREV (Addgene, 12253) and 1.8 μg pRRE (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542; http://n2t.net/addgene:62542; RRID: Addgene_62542). 250 ng/μl of Cas9 mRNA and 50 ng/μl of gRNA(s ...
-
bioRxiv - Genetics 2023Quote: ... and a 3’ UTR harboring the WPRE element was cloned in the pT7-PEmax for IVT plasmid (Addgene 178113)2 ...
-
bioRxiv - Immunology 2022Quote: ... and mSGK3 exon 3 (TTCAAGACATTAAATGCAG) were designed using the online tool CHOPCHOP (http://chopchop.cbu.uib.no/) and cloned into TLCV2 (Addgene plasmid # 87360,) as described previously5455 ...
-
bioRxiv - Plant Biology 2022Quote: The longer and shorter transporter 3′ UTRs were cloned into the dual luciferase construct pGreen_dualluc_3′UTR_sensor at EcoRI sites (Addgene, Cat: 55206). The longer 3′ UTRs without AU-rich elements were amplified using flanking PCR methods ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was injected into worms along with a plasmid containing transposase (pCFJ601, Peft-3::Mos1 transposase, Addgene #34874) and co-injection markers (pGH8 Addgene #19359 ...
-
bioRxiv - Neuroscience 2024Quote: ... P1-3 pups were injected with 360 nL of AAV1-FLEX-tdTomato (titer: 2.5×1013 vg/mL, Addgene #28306) per cortical hemisphere ...
-
bioRxiv - Molecular Biology 2024Quote: ... and subsequently fused in-frame with the GFP reporter gene with unc-54 3′UTR which was amplified from pPD95.75 plasmid (Addgene) using GFP_C and GFP_D primers (Table S1) ...
-
bioRxiv - Neuroscience 2024Quote: ... NTC-R aaactaaaccaggtgcctcagccgc-3′) were then annealed and cloned into the BsmBI cloning site of lentiGuide-puro (Addgene #52963) plasmid that contains a U6 promoter driving the expression of the specific P2ry13 or NTC gRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Supplementary Table 3) were individually inserted downstream of the U6 promoters in the corresponding plasmids: pMJ114 (bovine U6; RRID:Addgene_85995), pMJ179 (mouse U6 ...
-
bioRxiv - Developmental Biology 2024Quote: ... P{w[+mC]=UAS-FLAG-HA-FP4mito}3 (Bloomington Cat#58481; RRID:BDSC_58481) and Halo7 was amplified from UAS-7xHalo7::CAAX (Addgene # 87647) (Sutcliffe et al ...