Labshake search
Citations for Addgene :
951 - 1000 of 1463 citations for 3 2 Methylphenoxy methyl piperidine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: The CRISPRi Calu-3 cell line was generated by lentiviral delivery of pMH0001 (UCOE-SFFV-dCas9-BFP-KRAB) (19) (Addgene #85969) into Calu-3 cells ...
-
bioRxiv - Genomics 2023Quote: sgRNAs targeting 3 different locations in the genome were cloned into a modified version of pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955), where BFP was replaced by superfolder GFP (sfGFP ...
-
bioRxiv - Bioengineering 2023Quote: ... gBlocks were created for this sequence with a C-terminal “LPETG” Sortase recognition site and complementary 5’ and 3’ overhangs to the BamHI/HindIII double digested pCARSF63 Thioredoxin-SUMO fusion expression plasmid (Addgene #64695).89 The resulting gBlocks were ligated into pCARSF63 expression plasmids using Gibson assembly (NEB ...
-
bioRxiv - Genomics 2023Quote: ... and flanking regions of respective ER localized proteins were inserted into a backbone containing a UCOE-EF-1α promoter and a 3′ WPRE element (Addgene #135448) (Jost et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... Human RFX6 cDNA clone was purchased from Horizon Discovery (OHS6084-202637733) and gateway sub-cloned from its entry vector pENTR223 into the expression vector pCSf107mT-Gateway-3⍰myc (Addgene 67617) using clonase (ThermoFisher 11791020 ...
-
bioRxiv - Genetics 2023Quote: ... The plasmids p-yMCR.EGFP and p-yDR.EGFP were co-injected with transient sources of a single guide RNA targeting exon 2 of the yellow gene (pCFD3-dU6:3-y1-sgRNA) and Cas9 (pBS-Hsp70-Cas9, a gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger - Addgene plasmid # 46294) into a w1118 stock (BDSC #3605) ...
-
bioRxiv - Microbiology 2023Quote: ... The guide RNA was designed against exon 3 of p62 and cloned into a gRNA cloning vector plasmid (Addgene No. 41824). The Cas9 enzyme encoding hCas9 plasmid was from Addgene (No ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of diluted CaMKII.GCaMP6f (AAV1, diluted 1:3 with dPBS or AAV9, diluted 1:10 with dPBS, Addgene number: 100834) was injected in three locations throughout auditory cortex (1.5 mm from lambda ...
-
bioRxiv - Bioengineering 2023Quote: ... is based on Addgene 12150770. AAV-sgmir96-Master (Supplementary Fig. 3) is based on pAAV-U6-sgRNA-CMV-GFP (Addgene 85451)71 ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Immunology 2023Quote: ... the gRNA oligonucleotides against murine mesothelin (5’- ATGTGGATGTACTCCCACGG-3’) (synthesized by Dr. Genewiz, MA, USA) were cloned into lentiCRISPRv2 hygro vector (Addgene# 98291) as previously reported55 ...
-
bioRxiv - Microbiology 2022Quote: GFP and myc-tagged 14-3-3ε were generated as follows: a G-block containing the full-length 14-3-3ε protein (IDT) was cloned into pEGFP-C1 (Addgene #2487) using XhoI and BamHI restriction sites ...
-
bioRxiv - Biophysics 2022Quote: An sgRNA targeting the 3’UTR of TCOF1 proximal to the stop codon was cloned into the Cas9-containing plasmid PX458 (Addgene, 48138) by golden gate cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... the guide sequence 5’- GCCCCCAGCCTCTGCGG-3’ was cloned into the vector pSpCas9(BB)-2A-eGFP (PX458 plasmid a gift from Feng Zhang, Addgene #48138). Homology directed repair templates were designed to contain 1000bp homology arms flanking the region to be edited ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA or a tandem cassette of 3 gRNAs targeting FBXL4 was cloned into AAV-U6-gRNA-CAG-mtKeima-WPRE-hGHpA (modified from Addgene, 60229) under the U6 promoter ...
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Systems Biology 2022Quote: ... and added undiluted to K562 cells for a final cell concentration of 3-4 x 105 cells/mL for pJT126-based effector recruitment vectors (Addgene #161926) or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The vector V2 CRISPR DNA Plasmid (1ug) was co-transfected in 293T cells along with 3 µg of the viral envelope PMD2 (Addgene # 12259) and 4 µg of the viral packing PsPAX (Addgene #12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR-amplified fragment of pie-1p::gfp::PH::pie-1 3’UTR was inserted into pCFJ1662 (a gift from Erik Jorgensen, Addgene #51482). Plasmid mixtures containing pCFJ1662_PH ...
-
bioRxiv - Cell Biology 2023Quote: ... PH-FFAT/N-PH-FFAT sequences (5’-NheI/3’-AscI) were amplified by PCR from pLJM1-FLAG-GFP-OSBP plasmid (Addgene#134659). The sequences encoding Twitch (Twitch2b/Twitch7x/Twitch8x/Twitch9x ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEFL knock-in (5’ – GTAGCTGAAGGAACTCATGG – 3’) were designed by DESKGEN tool and subcloned into pSpCas9(BB)-2A-GFP (Addgene, 48138) with BbsI-HF (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... NT#3-TTGGATGGGAAGTTCACCCCG) or IP3R1-targeting shRNA (ULTRA3316782- TTTCTTGATCACTTCCACCAG) were packaged as lentiviral particles using packaging (pCMV- dR8.2 dpvr, Addgene, plasmid #8455) and envelope vectors (pCMV-VSV-G ...
-
bioRxiv - Cell Biology 2023Quote: ... bound to FOXM1-chDNA1 or gRNAs (5’-GCA GGC AGA GCG TAA GCA AA-3’ and 5’-GGA CAC ACG TTT AAT CGA GT-3’) bound to FOXM1-chDNA3 was cloned into the pX335 vector (Addgene, 42335) before the gRNA scaffold ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the SINAPs plasmid from the Singer lab (Addgene #84561)44 and a tdTomato-FL2 (containing the 3’UTR of FL2) plasmid previously cloned in-house using the tdTomato-C1 vector (Addgene #54653), a human FL2 clone in pANT7_cGST (DNASU ...
-
bioRxiv - Cell Biology 2024Quote: PINK1 KO cells were generated using CRISPR-Cas9 with a PINK1 targeting sgRNA (5’-CACCGTACCCAGAAAAGCAAGCCG-3’) cloned into pU6-(BbsI)-CBh-Cas9-T2A-mCherry (Addgene, #64324). This plasmid was transfected into hTERT-RPE1 Flp-In TREX cells followed 24 h later by fluorescence-activated cell sorting (FACS ...
-
bioRxiv - Molecular Biology 2024Quote: ... a sgRNA (5’-GCTAGTGGAGAACTTGGAAA-3’) targeting the R164-allele of PCNA exon 5 was cloned into hSpCas9(BB)-2A-GFP (PX458, Addgene 48138). A double-stranded donor was constructed with a point mutation to revert the arginine (AGA ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transduced at an MOI < 0.3 with virus made via the pJR103 dual guide RNA plasmid (a kind gift from Marco Jost & Jonathan Weissman, Addgene #187242) (33) ...
-
bioRxiv - Physiology 2024Quote: ... a sgRNA was designed for exon 5 of PKHD1 (5’-3’ ACTTCCTGGAAGCATACTTC) and cloned into a pX330 plasmid (Addgene plasmid, 42230). HCD cells were transfected with the sgRNA encoding plasmid and pAcGFP1-C1 plasmid using FuGENE (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CAC CGG GAG CAT TTG CGC TTG CGG C-3’ and 5’-AAA CGC CGC AAG CGC AAA TGC TCC C-3’ comprising the VPS35 guide RNA were annealed and inserted into the pLentiCRISPRv2 (Addgene, 49535) vector ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CAC CGT TCA TAC CTC AAG CGG ACA T-3’ and 5’-AAA CAT GTC CGC TTG AGG TAT GAA C-3’ comprising the VPS26 guide RNA were annealed and introduced into pLentiCRISPRv2 hygro (Addgene, 98291). Lentivirus was produced as described above and transduced into VPS35 KO cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... ABE-SpRY-OPT plasmid was created by inserting the 3’UTR+poly-A fragment in the pCMV-T7-SpRY-P2A-EGFP (RTW4830) (Addgene #139989) plasmid ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5’-AATTGAGCTCGATGAGCGGCCTGGTGC-3’ and rev: 5’- AATTGGATCCTTATTGCGAGTACACCAATTCATTCATG-3’ and inserted between SalI and BamHI sites of pQE-80L MBP-SspB Nano plasmid (Addgene #60409) by using restriction digestion and T4 ligase ligation process.
-
bioRxiv - Cell Biology 2024Quote: Codon-optimized genes encoding His6-HTP-3 residues 2-739 and HIM-3 residues 1-291 were cloned as a polycistronic cassette into a single vector (UCB Macrolab 2B-T; Addgene #29666), resulting in an N-terminal His6-tag fused to HTP-3 (Kim et al ...
-
bioRxiv - Cell Biology 2024Quote: ... the miniIAA7 sequence was amplified using primers miniIAA-5-XbaI and miniIAA-3-XbaI as well as pSH-EFIRES-B-Serpin-miniIAA7-mEGFP plasmid DNA (Li, Prasanna et al. 2019) (ADDGENE: #129719) as a template ...
-
bioRxiv - Cell Biology 2024Quote: ... The complete ORF of AtAFB2 was amplified using primers AtAFB2-5-XbaI and AtAFB2-3-HindIII as well as pSH-EFIRES-P-AtAFB2 plasmid DNA (Li, Prasanna et al. 2019) (ADDGENE: #129715) as a template ...
-
bioRxiv - Cell Biology 2024Quote: ... for whole-body over-expression was constructed by cloning the ubiquitously-expressed eef-1A.1 (formerly eft-3) promotor into the plasmid pPD117.01 (A gift from Andrew Fire, Addgene plasmid #1587) for expression in C ...
-
bioRxiv - Cancer Biology 2024Quote: ... a human VEGFC target oligonucleotide (5′-GAGTCATGAGTTCATCTACAC-3′) was cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene plasmid # 42230). Two VEGFCKO clones were obtained by PEI transfection (Tebu Bio ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with pEGFP-LC3 (EGFP-LC3: microtubule associated protein 1 light chain 3 fused with enhanced green fluorescent protein) (Addgene, 24920) at 0.1 µg of the plasmid (in 50 µl Opti-MEM® Reduced Serum Media ...
-
bioRxiv - Genetics 2024Quote: ... targeting the 5’ and 3’ ends of the ao gene into pCFD4 U6:1_U6:3tandemgRNAs (Port et al. 2014; Addgene plasmid #49411). The repair template sequence ...
-
bioRxiv - Developmental Biology 2024Quote: HEK293T cells were grown in 10-cm dishes to 80% confluency before transfection with the lentiviral vector (10 μg) with packaging vectors including pMD2.G (3 μg, Addgene, # 12259), psPAX2 (6 μg ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2.5 ng/mL Pmyo-2::mCherry as a co-injection marker (pCFJ90, Addgene #19327). Microinjection of adult N2 hermaph-rodites was performed as described above ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
bioRxiv - Biochemistry 2021Quote: ... Individual nsp10 was expressed from plasmid SARS-CoV-2 3xFlag-nsp5CS-nsp10 (Addgene ID 169157) containing the N-terminal 3xFlag tag (MDYKDHDGDYKDHDIDYKDDDDK) ...
-
bioRxiv - Biophysics 2021Quote: The plasmid with cDNA encoding SARS-Cov-2 spike HexaPro (S) was obtained from Addgene. To express the S protein ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G, Addgene #12259) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a 2 mL transfection mixture containing lentiviral packaging plasmids 7.5 µg pMD2.G (#12259, Addgene), 11.4 µg pMDLg-RRE (#12251 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HN30 and HN31 cell lines were transfected with 2 μg mCherry (Addgene, Plasmid 41583) as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... we used an existing CMV-driven SARS-CoV-2 plasmid (pcDNA3.1-SARS2-Spike, Addgene 145032)(Shang et al. ...