Labshake search
Citations for Addgene :
951 - 1000 of 2996 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... and 5 μg/flask of psPAX2 (Addgene 12260) using EndoFectin Lenti transfection reagent (GeneCopoeia ...
-
bioRxiv - Immunology 2024Quote: ... with 5 µg of HA-HIF1alpha (Addgene#18949) and HA-HIF1alpha P402A/P564A-pcDNA3 (Addgene#18955) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 ug of ATP1A1_plasmid_donor_RD (Addgene plasmid, #86551). Cells were electroporated using the Neon Transfection System (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µg of pMD2.G (#12259, Addgene) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids used in this work are listed in Supplementary Table 6 and are available from Addgene (identifiers listed in Supplementary Table 6).
-
bioRxiv - Cancer Biology 2021Quote: ... A doxycycline-inducible Cas9 clonal cell line of NALM-6 (using plasmid pCW-Cas9, Addgene #50661) was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 µg psPAX2 and 3.6 µg pMD2G (gift from the Trono lab, Addgene #12259 and #12260) packaging plasmid using CalPhos Mammalian Transfection Kit (Takara) ...
-
bioRxiv - Neuroscience 2022Quote: ... Ir21a-Gal80 was created by subcloning the Ir21a promoter region into pBPGAL80Uw-6 (Addgene plasmid # 26236) [28 ...
-
bioRxiv - Immunology 2021Quote: ... TPC2(L564P):GCaMP6s and TPC2(L265P/L564P):CaMP6s sequences were amplified (forward primer, 5’-TCCGAATTCAATGGGTTCTCATCATCATCATCATCA-3’, reverse primer, 5’-GATACCGGTTGCAACTTCGCTGTCATCATTTGTACAAAC-3’) and subcloned into mApple N1-vector (Addgene #54567) via EcoRI und AgeI sites.
-
bioRxiv - Neuroscience 2020Quote: ... via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... two guide RNA sequences (gRNA 5’ TTGGGGGGGCTACTGCCAGC 3’ and 5’ CTTGAACGCCACCCTCTAAC 3’) were cloned into pspCas9(BB)-2A-GFP (Addgene; #48138) and pspCas9(BB)-2A-RFP (Addgene ...
-
bioRxiv - Biophysics 2022Quote: Human kinesin-5 (Kif11/Eg5) 5-513 was PCR amplified from mCherry-Kinesin11-N-18 plasmid (gift from Michael Davidson, Addgene # 55067). This fragment was previously shown to form functional dimers [19] ...
-
bioRxiv - Molecular Biology 2021Quote: ... the annealed oligos to target CRY1 (Sense: 5′ CACCGCCTTCAGGGCGGGGTTGTCG 3′; and Antisense: 5′ AAACCGACAACCCCGCCCTGAAGGC 3’) was inserted into BsmBI of LentiCRISPRv2 plasmid (Addgene #: 52961).
-
bioRxiv - Biochemistry 2021Quote: ... guide sequences 5’GGCATTGCCCGTCATGGCCC3’ and 5’GTCTTCACCGAGCTCATTAA3’ were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang; Addgene plasmid # 42230) and co-transfected with a GFP-expressing plasmid into HCT116 cells using Lipofectamine 2000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of plasmids expressing sgRNAs (5′- ATTGTGATATCCGATAGTGAT-3′ and 5′-GTTCTGTCAGTGTGAAGAGG-3′) and Cas9 followed by the 2A-Puromycin cassette (pX459, Addgene #62988). 24 h after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-iLID was amplified using 5’-GGTAGTAGTGGTAGTAGTATGGTGAGCAAGGGCGA-3’ and 5’-TCGAAGCTTGAGCTCGAGATCTTTAAAAGTAATTTTCGTCGTTCGCT-3’.The fragments were inserted into a pEGFP-C1 vector (Addgene 46956) using the AgeI/BglII restriction sites.
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... gRNA sequences targeting Apc (5-CAACTTCTGGTAATGGTC-3) or Trp53 (5-AATGAGGCCTTGGAACTCA-3) were cloned into the Px330 vector (Addgene plasmid #42230). Organoids were removed from Matrigel using Dispase II (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... Guide RNAs (FANCC: 5’-GCAAGAGATGGAGAAGTGTA-3’ and MSH2: 5’-GTGCCTTTCAACAACCGGTTG-3’) were cloned into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene#48138). AHH-1 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... a sgRNA (5’-GCTAGTGGAGAACTTGGAAA-3’) targeting the R164-allele of PCNA exon 5 was cloned into hSpCas9(BB)-2A-GFP (PX458, Addgene 48138). A double-stranded donor was constructed with a point mutation to revert the arginine (AGA ...
-
bioRxiv - Physiology 2024Quote: ... a sgRNA was designed for exon 5 of PKHD1 (5’-3’ ACTTCCTGGAAGCATACTTC) and cloned into a pX330 plasmid (Addgene plasmid, 42230). HCD cells were transfected with the sgRNA encoding plasmid and pAcGFP1-C1 plasmid using FuGENE (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: ... from Origene PANX1 human 29-mer shRNA kit in pRS vector (#TR302694) (sequence: 5’- CGCAATGCTACTCCTGACAAACCTTGGCATGTCAAGAGCATGCCAAGGTTTGTCAGG AGTAGCATTGTT-3’) plus a GFP shRNA cassette (5’GCCCGCAAGCTGACCCTGAAGTTCATTCAAGAGATGAACTTCAGGGTCAGCTTGCT TTTT-3’) from Addgene (#30323) as a control ...
-
bioRxiv - Cell Biology 2024Quote: ... a FLAG-RPB1-N792D-ΔCTD fragment was PCR amplified (Forward primer: 5’ – CAATTCCACAACACTTTTGTCTTATACTTGGATCCATGGACTACAAGGACGACGATGACA - 3’; Reverse primer: 5’ – TAGGGGGGGGGGAGGGAGAGGGGCCGGCCGGGGCTCAGCTGGGAGACATGGCACCAC – 3’) from FLAG-Pol2-WT (Addgene, 35175) (55 ...
-
bioRxiv - Developmental Biology 2024Quote: ... as well as non-targeting control gRNAs80 were synthesized with overhangs (sense: 5′-ACCG, antisense: 5′-AAAC) subcloned into the BsaI sites of pGL3-U6-sgRNA-EGFP (Addgene # 107721)81.
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1-shCltc1/ shCltc2/ shCltc3 were individually cotransfected with psPAX2 (ADDGENE NO. 12260), pMD2.G (ADDGENE NO ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3.1-GFP(1-10) was a gift from Bo Huang (Addgene plasmid # 70219). 2PH-PLCdelta-GFP was a gift from Sergio Grinstein (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478) and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453). Lentivirus was generated as described previously (Ferraiuolo et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... High titer (>1012GC/ml) AAV2/1-hSyn-Cre-WPREhGH virus (Addgene 105553-AAV1) was diluted 1:8 or 1:4 in 0.9% saline and 1µl was injected under the forepaw skin ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Rab1060 was obtained from Addgene (#49472) and pET17b-Kif5b(1-560)-GFP-His61 was obtained from Addgene (#15219).
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid pCMV delta R8.2 encoding HIV-1 GagPol (Addgene, plasmid #12263) using Fugene 6 (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV9-CaMKIIα-hChR2(E123A)-EYFP (titer: 1×1013 viral genomes/mL; Addgene: 35505); GAD1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nontargeting shRNA pLKO.1-blast-SCRAMBLE was obtained from Addgene (Catalog #26701). Two shRNAs for each target were obtained and stable lentiviral transductions with the targeted shRNAs and the scramble control were performed ...
-
bioRxiv - Cell Biology 2021Quote: ... The Lentiviral backbone transfer plasmid p-lentiCRISPR - EGFP sgRNA 1 (Addgene Cat #51760) was used to express human codon-optimized Cas9 protein ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were transfected with GFP-swiprosin-1 and GBP-Apex (Addgene plasmid 67651) constructs using a Neon transfection system (as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID: 19119) (36) ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells were transduced with lentivirus packaged with pLentiCas9-Blast (Addgene, 52962) generated from HEK293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... the AAV11 Cap fragment was inserted into pAAV-RC2/1 vector (Addgene, #112862) by T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392); pMDLg/pRRE (gift from Didier Trono ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guide RNA (supplementary table 1) were cloned into pCFD3-dU6:3gRNA (Addgene 49410) digested by BbsI using annealed oligonucleotides ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-hSyn-hChR2-eYFP (UPenn Vector Core AV-1-26973P / Addgene 26973-AAV1) or AAV1-CamKIIa-hChR2-mCherry (UPenn Vector Core AV-1-26975 / Addgene 26975-AAV1 ...
-
bioRxiv - Neuroscience 2021Quote: ... or control virus (AAV8-hsyn-DIO-mCherry) (1×1013 VG/ml; Addgene, 50459) into 3 NBM/SI sites (350 nl/site ...
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)