Labshake search
Citations for Addgene :
951 - 1000 of 2400 citations for 1 2 4 4 4 Pentachloropentafluorobutane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... expressing Cas9 nuclease and two gRNAs (see below for sequences) together with the CRIS-PITCh vector pX330S-2-PITCh (63670, Addgene), harboring the Lamin A microhomologies and GFP-Puro or GFP-Neo/Kan insertions ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Supplementary Table 2) into the BbsI restriction sites of the pX459 vector (#62988, Addgene). An empty pX459 vector was used to generate matching control cell lines ...
-
bioRxiv - Cell Biology 2023Quote: ... the resistance cassette flanked by LoxP sites (Sec16) was excised by transfection of 2 µg of pBS598 EF1alpha-EGFPcre plasmid (plasmid #11923; Addgene) that encodes for cre recombinase.
-
bioRxiv - Microbiology 2024Quote: ... Plasmids encoding spikes of SARS-CoV-2 variants Delta (Cat. No. 172320) and Omicron (Cat. No. 179907) were procured from Addgene, USA.
-
bioRxiv - Biophysics 2023Quote: ... and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Genomics 2022Quote: The PCR product was cloned into the pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 vector (Addgene #6125554) using HindIII and XbaI restriction sites ...
-
bioRxiv - Biophysics 2023Quote: ... cells transfected with pcDNA3.1-mGL-picALuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Biophysics 2023Quote: ... RRID:Addgene_141370)72 or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... A549 cells were transfected with 2 µg DNA of ARF1-GFP48 (ARF1-GFP was a gift from Paul Melancon, Addgene plasmid #39554 ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were transiently co-transfected for 24 h with plasmids for expression of full-length, N-terminal tagged (Flag, HA or tandem Strep tag) BRSK1/2 (or Cys-Ala mutants) and EGFP-TAU (Addgene), using 3:1 polyethylenimine (average Mw ...
-
bioRxiv - Cancer Biology 2024Quote: ... with the plasmid of interest (POI) and two plasmids encoding packaging proteins for viral vector (pAX.2 Addgene Plasmid #35002), pMD2.G Addgene Plasmid #12259) ...
-
bioRxiv - Cancer Biology 2024Quote: ... targeting two regions of ATP5I’s cDNA (sgATP51 #1 and sgATP5I #2) and one RNA guide targeting GFP (sgGFP) sequence were subcloned into BsmBI restriction site of lentiCRISPRv2 plasmid (#52961, Addgene). For re-expression of ATP5I in control (sgGFP ...
-
bioRxiv - Plant Biology 2024Quote: ... two suitable sgRNA targeting ICL - exon 2 were designed using CRISPOR (Concordet and Haeussler, 2018) and cloned in pDGE Shuttle vectors (Addgene plasmid #153241 pDGE332 and Addgene plasmid #153243 pDGE334 ...
-
bioRxiv - Immunology 2024Quote: ... lentiviral particles were produced by co-transfection of 2 × 106 293T cells with 5 μg of LentiCRISPRv2GFP plasmid (Addgene # 82416) expressing the gRNA targeting the gene of interest or non-targeting control (CTRL ...
-
bioRxiv - Neuroscience 2024Quote: ... or 2 μg of a dominant-negative PAK1 plasmid (pCMV6M-PAK1 H83L H86L K299R, Addgene plasmid # 26592 by Jonathan Chernoff). This transfection was maintained for two days ...
-
bioRxiv - Neuroscience 2024Quote: ... Titer: 2 × 1012 virus molecules/ml) and placed a second microinjection of 200 nl of AAV8-hSyn-DIO-mCherry (Addgene, Catalog#50459-AAV8 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-hSyn-GCaMP6f-P2A-nls-dTomato virus (titer 2 × 1013 GC/mL) that co-expresses GCaMP and nucleus-localized static tdTomato signals was purchased from Addgene, which was a gift from Jonathan Ting (Addgene viral prep #51085-AAV1 ...
-
bioRxiv - Molecular Biology 2024Quote: We transfected HAP1 cells with 2 µg of pX330 U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230; (Cong et al, 2013)) containing LAD-specific or AVVS1-specific guide RNAs ...
-
bioRxiv - Plant Biology 2024Quote: ... the BlpR cassette was replaced by a hygromycin resistance gene under control of the switchgrass polyubiquitin 2 promoter and the 35S terminator derived from plasmid JD633 (Addgene no ...
-
bioRxiv - Neuroscience 2024Quote: ... (2) PV-Cre mice were injected with Cre-dependent retrograde AAVrg-hSyn-DIO-EGFP (1.4E13 GC/ml, Addgene, #50457-AAVrg) or AAVrg-FLEX-tdTomato (1.2E13 GC/ml ...
-
bioRxiv - Biophysics 2024Quote: ... The cloning of 2×Cox8-mGold-HaloTag was synthesized by Tsingke Biotech (Beijing, China) by referencing mEmerald-Mito-7 (plasmid 54160, Addgene) using seamless cloning.
-
bioRxiv - Neuroscience 2022Quote: ... then virus (AAV9-CaMKII-Cre, stock 2.1*1013 particles/nL, 1:1 dilution in PBS, Addgene) was pressure injected (NanoJect III ...
-
bioRxiv - Neuroscience 2021Quote: The lentiviral knockdown constructs were made using pLKO.1-Puro or pLKO.1-GFP plasmids (Addgene) (Zhuang et al ...
-
bioRxiv - Neuroscience 2024Quote: ... 3.26e14 GC-ml) diluted 1:1 with PBS or AAV5-CaMKII-GCaMP6f.WPRE.SV40 (Addgene, 2.3e13 GC-ml) diluted with PBS 1:2 into dorsal CA1 (−1.8 mm from Bregma ...
-
bioRxiv - Molecular Biology 2020Quote: ... and residues 1-133 (Addgene #138422) were PCR amplified from pcDNA4/TO-ORF24-3xFLAG (19 ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-puro plasmids (Addgene #8453) were cloned as previously described (78) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 Scrambled shRNA (#1864, Addgene), pLKO.1 HIF2α shRNA (#TRCN0000082307 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1-TRC (shSCR) (Addgene; 10879) was used as a control ...
-
bioRxiv - Microbiology 2020Quote: ... and AdEasier-1 cells (Addgene #16399) were a gift from Bert Vogelstein (He et al ...
-
bioRxiv - Biochemistry 2022Quote: ... cloned into pMSCVpuro (Addgene #K1062-1) at Hpa1 and EcoR1 sites to create pMSCVpuro-His-mCherry ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Developmental Biology 2020Quote: ... pLKO.1-shSCR (Addgene, Plasmid #1864), was obtained from Addgene (Cambridge ...
-
bioRxiv - Immunology 2023Quote: ... pLKO.1 puro vector (Addgene, #8453) expressing control or Il5ra shRNAs ...
-
bioRxiv - Biochemistry 2023Quote: ... and PSPAX2 (1 μg, Addgene 12,260) in 600 μL per plate OPTIMEM and Lipofectamine 2000 transfection reagent (Invitrogen 11668027 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 µg psPAX2 (Addgene 12260) using PEI and following standard protocol.Viral supernatant was harvested after 60 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μg psPAX2 (Addgene 12260) using PEI and following standard protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... pLenti-CMV-Hygro (w117-1) (Addgene, 17454 a gift from Eric Campeau & Paul Kaufman) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg pMD2.G (AddGene G12259) and 3 μg psPAX2 (AddGene 12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg pCXLE-hSK (Addgene #27078), and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077 ...
-
bioRxiv - Molecular Biology 2023Quote: The pLKO.1 (Addgene plasmid #13425) lentiviral vector carrying the neomycin resistance gene was used to express shRNA sequences in targeted cells ...
-
bioRxiv - Microbiology 2022Quote: ... 1 -hygro vector (Addgene, plasmid #24150) was used to generate the pLKO.1-hygro-AMOTL1-sh construct ...
-
bioRxiv - Microbiology 2022Quote: ... psPAX2 (HIV-1 gag/pol) (Addgene) and pMD2.G (encoding VSV-G ...
-
bioRxiv - Cell Biology 2024Quote: ... The pLKO.1 vector (Addgene, 10878) was digested with AgeI-HF (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... and psPAX2 (1 µg, Addgene #12260), and 20 µl of polyethylenimine (PEI ...
-
bioRxiv - Genomics 2024Quote: ... pLKO.1 puro (#8453 from Addgene). Two different shRNA lentiviral constructs were used for each target gene ...
-
bioRxiv - Neuroscience 2024Quote: ... EGFP-N1 (RRID: Addgene 6085-1). HeLa cells were transfected with 1.5 µg of untagged human Parkin (RRID ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg of Cre (Addgene 12313381) and 1 µg of Flippase (Addgene 1379382 ...