Labshake search
Citations for Addgene :
51 - 100 of 134 citations for beta Tubulin III Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... GSK3β-S9A (HA GSK3 beta S9A pcDNA3 was a gift from Jim Woodgett, Addgene plasmid # 14754). Plasmids were purified from a host E ...
-
bioRxiv - Microbiology 2020Quote: ... GSK3β-WT (HA GSK3 beta wt pcDNA3 was a gift from Jim Woodgett, Addgene plasmid # 14753), GSK3β-S9A (HA GSK3 beta S9A pcDNA3 was a gift from Jim Woodgett ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant SidK1-278 encoded by plasmid pSAB35 (Addgene plasmid #175787) was expressed in E ...
-
bioRxiv - Cell Biology 2021Quote: RPE cells stably expressing L304-EGFP-Tubulin (Addgene #64060, Watertown, MA) were generated by lentiviral transduction and placed under 10 µg/mL Puromycin selection for 5-7 days ...
-
bioRxiv - Cell Biology 2021Quote: The pIRESneo-EGFP-alpha Tubulin plasmid was obtained from Addgene (USA) and mutation (Y224G ...
-
bioRxiv - Cell Biology 2022Quote: ... pKanCMV-mRuby3-18aa-Tubulin was a gift from Michael Lin (Addgene plasmid # 74256 ...
-
bioRxiv - Microbiology 2019Quote: ... ADRB1 was amplified from pcDNA3 Flag beta-1-adrenergic-receptor (gift from Robert Lefkowitz; Addgene plasmid # 14698). All fragments contained ~20bp overhangs and were assembled into EcoRV cut pLenti CMV Puro DEST (w118-1 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Microbiology 2022Quote: ... pCMV encoding HIV-1 Vpr fused to beta lactamase (pCMV4-BlaM-Vpr) was obtained from Addgene (21950). A plasmid encoding replication-incompetent HIV-1 lacking env and vpr and encoding luciferase (pNL4-3LucR-E- ...
-
bioRxiv - Biochemistry 2022Quote: ... The recombinant human PRKACA cDNA was obtained from Addgene (Plasmid #23495) and cloned into between BamHI and KpnI in pcDNA5 vector (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: Plasmids used in generating recombinant SA11 rotaviruses were obtained from Addgene [https://www.addgene.org/Takeshi_Kobayashi/] and included pT7/VP1SA11 ...
-
bioRxiv - Cell Biology 2023Quote: ... transduced with recombinant adeno-associated virus (rAAV) (Addgene, pAAV TBG FFLuc) supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral plasmids expressing H2B-mCherry or EGFP-Tubulin were purchased by Addgene (CSII-prEF1a-mCherry-3xNLS ...
-
bioRxiv - Microbiology 2022Quote: ... mCh-alpha-tubulin was a gift from Gia Voeltz (Addgene cat. 49149), while pcDNA-D1ER was a gift from Amy Palmer & Roger Tsien (Addgene cat ...
-
bioRxiv - Cell Biology 2022Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104433 ...
-
bioRxiv - Neuroscience 2022Quote: ... pCAG tubulin GFP was a gift from Felicitas Proels & Martin Scaal (Addgene plasmid #66105 ...
-
An in vitro platform for quantifying cell cycle phase lengths in primary human intestinal stem cellsbioRxiv - Cell Biology 2023Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid #104433 ...
-
bioRxiv - Cell Biology 2022Quote: ... subcloning from the following constructs: XLone-Axin-tdmRuby3 (above) and Human Beta-catenin GFP purchased from Addgene (#71367). The following primers were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613; http://n2t.net/addgene:60613; RRID:Addgene_60613 ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Cell Biology 2020Quote: ... The pShuttle mCherry-Tubulin adenoviral vector (Tub-WT) was purchased (Addgene; Plasmid # 2676842). Tubulin mutants have been generated using the pShuttle mCherry-Tubulin plasmid following recommendations of the Q5 site directed-mutagenesis kit from New England Biolab (#E0554) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... employing the construct pIRESneo-EGFP-alpha Tubulin (a gift from Patricia Wadsworth; Addgene plasmid #12298 ...
-
bioRxiv - Genomics 2021Quote: ... The plasmid pCI-neo beta catenin S33Y was a gift from Bert Vogelstein (Addgene plasmid # 16519; http://n2t.net/addgene:16519; RRID: Addgene_l6519).
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid, 49155; http://n2t.net/addgene:49155; RRID:Addgene 49155)) with primers ATGGTGAGCAAGGGCGAGGA and TTACCCTGTCTTATTGCTAAATGGAACGTAAAAGTTAGGACCCGAACGAGTGTAC TTGCCCCAAATGTG ...
-
bioRxiv - Genetics 2023Quote: ... a pDestTol2CG2-eye-bfp with the independent marker beta-crystaline:BFP a kdrl P-5’entry clone (Addgene, Santoro Lab), an EGFP-CAAX p-middle entry (Addgene ...
-
bioRxiv - Biophysics 2022Quote: Recombinant MBP-FUS construct was kindly gifted by Nicolas Fawzi (Addgene plasmid #98651) and was expressed in BL21 (DE3 ...
-
bioRxiv - Physiology 2019Quote: ... as were plasmids for recombinant production of PGC-1α (Addgene #1028 and 1029) (Puigserver et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant lentiviral particles were produced using a protocol provided by the manufacturer (Addgene). In brief ...
-
bioRxiv - Cell Biology 2022Quote: ... GCaMP6s-GTU construct was made based on mCherry-γ-Tubulin-17 backbone (Addgene #55050). GCaMP6s constructs were stably expressed in C2C12 cells to perform Ca2+ imaging ...
-
bioRxiv - Cell Biology 2022Quote: Microtubules were visualised by expressing a plasmid containing β-tubulin-mCherry (Addgene plasmid #175829).
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Microbiology 2020Quote: ... pmTurquiose2-Golgi (Beta-1,4-galactosyltransferase 1 1-61 Aa) in red is to show the Golgi apparatus (Addgene cat 36205) (27) ...
-
bioRxiv - Neuroscience 2022Quote: ... and simultaneously injected 150nL of a retrograde AAV expressing a td Tomato tag under the CAG (chicken beta-actin) promoter (rgAAV-CAG-td tomato; Addgene) (Tervo et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Genetics 2022Quote: ... 2015) flanked by 2X core sequence of the HS4 chicken beta globin insulator was cloned into a targeting vector (Addgene #92142) that contains homology arms of the mouse TIGRE genomic locus (Madisen et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... sapiens beta-2-adrenergic receptor used as a control in BRET2 experiments was a gift from Robert Lefkowitz (Addgene plasmid #14697). Mm Arr-2 (NP_796205.1 ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Developmental Biology 2020Quote: Recombinant Lentiviral Vector encoding Myoc Y437H was constructed from plasmids pLentCMV-GFP(Addgene 17448)(Campeau et al. ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... we generated AAV8-RIP1-mCherry-EGFP-LC3B plasmid by cloning the insulin/beta globin promoter and the mCherry-EGFP-LC3B construct (from Addgene construct #22418, (28)) into an AAV8 packaging plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant plasmid along with a pBabe-puro construct (Addgene, 1764; deposited by Dr. Hartmut Land) expressing mouse ATG16L1 variants was transfected into HEK293 ATG13_KO GFP-LC3B cells via Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and miRFP2 genes were PCR amplified and swapped with mClover2 in pmClover2-tubulin-C-18 plasmid (Addgene #56376) and with TagRFP675 in pTagRFP675-actin-C1 (Addgene #44277 ...
-
bioRxiv - Cell Biology 2022Quote: ... pKanCMV-mRuby3-18aa-Tubulin was a gift from Michael Lin (Addgene plasmid # 74256 ; http://n2t.net/addgene:74256 ; RRID:Addgene_74256) (Bajar et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104433 ; http://n2t.net/addgene:104433; RRID:Addgene_104433)49
-
bioRxiv - Neuroscience 2022Quote: ... pCAG tubulin GFP was a gift from Felicitas Proels & Martin Scaal (Addgene plasmid #66105 ; http://n2t.net/addgene:66105 ; RRID:Addgene_66105)(14) ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450; http://n2t.net/addgene:56450; RRID: Addgene_56450). mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...
-
An in vitro platform for quantifying cell cycle phase lengths in primary human intestinal stem cellsbioRxiv - Cell Biology 2023Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid #104433; http://n2t.net/addgene:104433; RRID:Addgene_104433), and pmScarlet_H2A_C1 was a gift from Dorus Gadella (Addgene plasmid #85051 ...