Labshake search
Citations for Addgene :
51 - 100 of 1753 citations for Mono 2 Ethyl 5 Oxohexyl Phthalate 13C4 99% Dehp Metabolite Vi 100Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (titer ≥ 1×1013 vg/ml, working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9 ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9; https://www.addgene.org/100833/RRID:Addgene_100833) was injected unilaterally into the DS (L = ±1.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... Animals received a single dose of AAV8.TBG.null or AAV8.TBG.p21 (5*10^12 units/ml) (Addgene) intravenously allowed 1 week wash-out period on normal diet ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5; http://www.addgene.org/52295/; RRID: Addgene_52925) was a gift of Baljit Khak ...
-
bioRxiv - Neuroscience 2023Quote: ... 400 nl of AAV2/5-CAG-dLight1.1 (1.7×1013 GC/ml, 111067-AAV5, Addgene, Watertown, MA, USA) was slowly injected into the DMS (n = 7 ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Neuroscience 2023Quote: 750 nl of rAAV.EF1a.DIO.hChR2(H134R).eYFP or rAAV.EF1a.DIO.eYFP (3-4 x 10^12 vg/ml, AAV5, University of North Carolina Vector Core; 1-2 x 10^13 vg/ml, AAV1, Addgene, 27056-AAV1 and 20298-AAV1) were injected into each hemisphere of the VTA of 3–4-month-old DAT-Cre mice ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (serotype AAV1, viral titer ≥ 5×1012 vg/mL; Addgene, Watertown, MA, USA), pAAV-hSyn-hM4D(Gi)-mCherry (serotype AAV retrograde ...
-
bioRxiv - Cancer Biology 2020Quote: ... or with 2 μg/ml puromycin (Gibco) (pTK93_Lifeact-mCherry; a gift from Iain Cheeseman, Addgene plasmid #46357) for 3 days ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/2-hsyn-DIO-hM4D(Gi)-mCherry was obtained from Addgene (plasmid #44362, 4.6×1012 GC/ml). For optogenetic activation ...
-
bioRxiv - Cancer Biology 2019Quote: ... a 20-mer sgRNA target sequence (5′-CTCAGAGGGGGCTCGACGCT-3′) at exon 2 of the TP53 gene was designed (28) and cloned into pX330 (Addgene #42230), which was a gift from Dr ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... and 210nl of Arch 3.0- eYFP (rAAV2-EF1a-double floxed-eArch3.0-eYFP; 5 × 1011 GC per ml; UNC Vector Core or eYFP (Addgene plasmid 20296 ...
-
bioRxiv - Neuroscience 2023Quote: A volume of 200 nL of pGP-AAV2/5-syn-FLEX-jGCaMP8m-WPRE (1.9×1012 pp/mL, Addgene; #162378) expressing the genetically encoded calcium indicator GcaMP8m was injected into the CA2 region of the right hemisphere at AP -2.0 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected the Cre-dependent constructs AAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 (5×1011 gc/mL; Addgene) and AAV-EF1a-DIO-eNpHR3.0-mCherry-WPRE (5×1012 gc/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... we co-electroporated animals at stage 46-47 with pGP-CMV-GCaMP6f (2 mg/mL, Addgene plasmid # 40755) and CMV-turboRFP (1mg/ml) ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Cell Biology 2019Quote: Wild-type or SURF4-deficient HEK293T cells that stably express EPO-eGFP and A1AT-mCherry were transfected with a plasmid expressing ERoxBFP (Addgene: 68126, a gift from Erik Snapp (99)) ...
-
Basolateral amygdala parvalbumin neurons report aversive prediction error to constrain fear learningbioRxiv - Neuroscience 2020Quote: ... AAV5-ef1α-DIO-hChR2(H134R)-eYFP (5.5×1012 GC/ml) (pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA was a gift from Karl Deisseroth (Addgene viral prep # 20298-AAV5 ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Neuroscience 2023Quote: ... Ntsr1-Cre and Rbp4-Cre mice were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” ...
-
bioRxiv - Neuroscience 2024Quote: ... Rats then received bilateral infusions of either AAV8-CAMKIIa-hM3D(Gq)-mCherry or AAV8-CaMKIIa-GFP (5×1012 vg/mL for both viruses; Addgene) into the VH (either A/P ...
-
bioRxiv - Neuroscience 2019Quote: ... the inhibitory channelrhodopsin stGtACR2 (soma-targeted Guillardia theta anion-conducting channelrhodopsin 2, pAAV_hSyn1-SIO-stGtACR2-FusionRed, titer > 1 x 1013 particles/mL, Addgene). The vectors were injected (0.5 µl each side ...
-
bioRxiv - Neuroscience 2022Quote: ... excitatory Gq-coupled DREADDs (hSyn-hM3Dq-mCherry-AAV1/2 viral stocks, 4.0 × 1011 GC/mL titer, plasmid #50474 from Addgene), and control construct (hSyn-enhanced green fluorescent protein (EGFP)-AAV2 1:10 dilution of viral stocks ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Neuroscience 2024Quote: ... into the DR and bilateral infusions of AAVretro-hSyn-DIO-EGFP (200 nL over 2 min; 1.3 x 1013 GC/mL, Addgene) into the BLA ...
-
bioRxiv - Neuroscience 2023Quote: ... 2014) AAV2-hSyn-DIO-hM4D(Gi)- mCherry vector (titer ≥ 5×10¹² vg/mL) was attained from AddGene (catalog number 44362-AAV2). Rats were anesthetized with 2.5% isoflurane ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Microbiology 2022Quote: Chemical-genetic screens were initiated by thawing 2 × 1ml aliquots (1.0 OD600 units/mL) of the Mtb CRISPRi library (RLC12; Addgene 163954) and inoculating each aliquot into 19ml 7H9 supplemented with kanamycin (10 μg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Neuroscience 2023Quote: ... a 50:50 mix of AAV8-CamKII-mCherry (Neurophotonics, Laval University, Quebec City, Canada, Lot #820, titre 2×1013 GC/ml) and AAVrg-CAG-GFP (Addgene, Watertown ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Neuroscience 2019Quote: ... AAVrg-CAG-GFP (titer: 5×1012 vg/mL, this construct was a gift from Edward Boyden to Addgene-viral prep # 37825-AAVrg) and AAVrg pmSyn1-EBFP-Cre (titer ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Neuroscience 2020Quote: Transfection for the CD63 overexpression construct was done as described above for siRNA transfection using 2 µg/mL of CD63-pEGFP (Addgene, USA) added for 5 h in Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...
-
bioRxiv - Neuroscience 2023Quote: ... was mixed in a 1:10 ratio with AAV5-syn-GCaMP6s and injected into PM and AAV5-Syn-SIO-eOPN3-mScarlet (2−1013 gc/mL; Addgene #125713) was injected into either LP ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...