Labshake search
Citations for Addgene :
51 - 100 of 105 citations for L Cysteinesulfinic acid monohydrate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... mice were microinjected 0.3 µl of AAV5-hsyn-NE2.1 (h-N01, WZ Biosciences) and 0.5 µl of AAV9-hsyn-jRGECO1a (100854, Addgene) to the left Cg1 (AP=2.2mm ...
-
bioRxiv - Developmental Biology 2021Quote: The Tg(fli1a:Brainbow1.0L)mu254 (flibow) transgenic fish was generated by cloning the CMV-Brainbow-1.0 L construct (Addgene #18721) downstream of the fli1a promoter62 ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Microbiology 2021Quote: pLenti.GFP.NLuc is a dual GFP/nanoluciferase lentiviral vector based on pLenti.CMV.GFP.puro that contains a GFP/nanoluciferase cassette separated by a picornavirus P2A self-processing amino acid motif cloned into the BamH-I and Sal-I sites (Addgene plasmid #17448 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
bioRxiv - Microbiology 2022Quote: ... were introduced into a previously described spike-expression plasmid containing D614G and a 21-amino-acid deletion in the cytoplasmic tail (Addgene 158762) (34) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sequence encoding the native signal peptide and ECD of GPR56 (amino acids 1-400) was subcloned from pCAG-hGPR56-IRES-GFP (from Christopher A Walsh, Addgene 52297) into pCEP4 (Invitrogen ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Biochemistry 2022Quote: ... corresponding to amino acids 629-633 of AR) of the eGFP-AR fusion protein73 was removed from peGFP-C1-AR (Addgene #28235) using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA fragment encoding TwCel5CAT was cloned (26 - 320 amino acid residues) into the pNIC-CH expression vector (AddGene, Cambridge, MA), which adds a C-terminal polyhistidine-tag (6xHis-tag ...
-
bioRxiv - Cell Biology 2023Quote: The EGFP-tr53BP1 construct was assembled using Gibson Assembly with a fragment of human 53BP1 (amino acids 1221-1709, Addgene #69531) (4 ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... (i) 0.5 μg of AAVS1-TALEN-L and AAVS1-TALEN-R (gift from Dr. Danwei Huangfu, Addgene plasmid # 59025) as well as 2 μg of targeting plasmid were used for nucleofection of hPSC cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... L-Myc or LacZ open reading frame (ORF) was cloned into pLEX_307 (a gift from David Root, Addgene #41392) using the Gateway® cloning methods according to manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: Following plasmids were used for transfection pN1-CMV-sDarken (Addgene plasmid #184799, pN1-CMV-L-sDarken (Addgene plasmid #184800), null-mutant of sDarken (created in house) ...
-
bioRxiv - Cell Biology 2020Quote: Human SH3 domain nucleotides (hLynSH3, amino acids 63-123) were amplified by PCR and cloned into a mammalian expression vector pEBG (Addgene, plasmid # 22227) with an N-terminal glutathione S-transferase (GST ...
-
bioRxiv - Developmental Biology 2021Quote: ... associated palmitoylated fluorescent protein was generated by the addition of the 20-amino acid sequence of ratGAP-43 MLCCMRRTKQVEKNDEDQKI to the N-terminus of the monomeric enhanced GFP (eGFP) (K. Svoboda, Addgene plasmid 18696) through sequential PCR amplification to make a pm-eGFP sequence ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Cell Biology 2020Quote: ... PA28γ ORF WT or minus the C-terminal 14 amino acids (ΔC) were cloned into pSBbi-Pur (a gift from E. Addgene plasmid #60523) according to (Kowarz et al. ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Neuroscience 2021Quote: ... A fragment containing three repetitions of the retinoic acid response element (RARE) sequence followed by the weak promoter SV40 was sub-cloned from pGL3-RARE-luciferase (Addgene Plasmid #13458), a kind gift of the Underhill Lab64 ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Cell Biology 2020Quote: ... and 75 ng/µl of a construct expressing a sgRNA targeting ACGGCTCATAAGAGACTTGG (derived from p46169, which was a gift from John Calarco, Addgene plasmid # 46169 ...
-
bioRxiv - Neuroscience 2022Quote: ... Rats received bilateral intra-accumbens infusions (1 μl/side) of a Cre-dependent adeno-associated viral vector (AAV) expressing eYFP (AAV5-EF1a-DIO-eYFP-WPRE-hGH; Addgene) or a Cre-dependent AAV expressing ChR2 with an eYFP tag (AAV5-EF1a-DIO-hChR2(H134R)-eYFP-WPRE-hGH ...
-
bioRxiv - Systems Biology 2022Quote: ... or in case of the aspC deletion the chloramphenicol (Cap) cassette from pKD3 (pKD3 was a gift from Barry L. Wanner (Addgene plasmid # 45604 ...
-
bioRxiv - Systems Biology 2022Quote: ... kanamycin resistance cassettes were generated via PCR – ‘KO’ primers with 50 bp homologous arms are listed in Supplementary Table S4 – using the kanamycin (Km) cassette from pKD4 (pKD4 was a gift from Barry L. Wanner (Addgene plasmid # 45605 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.1 μL of adeno-associated virus serotype 9 (AAV9) carrying GCaMP6f under the excitatory neuronal promoter CaMKII (AAV-CaMKII-GCaMP6f) (Addgene) to co-transfect the TRPV1 and GCaMP6f into neurons.
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2.5ul PLUS reagent with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene 35431) and TALEN-R (Addgene 35432 ...
-
bioRxiv - Neuroscience 2023Quote: ... into the DMS (0.3 µl) and of an AAV encoding the cre-dependent genetically encoded calcium indicator GCaMP8s (AAV9-Syn-FLEX-GcAMP8s-GFP, Addgene) into either the CeA or BLA (0.1-0.2 µl) ...
-
bioRxiv - Genetics 2021Quote: ... the cassette containing the C terminus half of the DddAtox (split at 1397 amino acid position) and UGI was amplified from the DdCBE plasmid (Addgene plasmid no. 157844). The PCR amplicon was digested with XbaI and BsU36I restriction enzyme and cloned in the pkTol2c-FusXTBE-N vector linearized with XbaI and Bsu36I to generate pkTol2c-FusXTBE-C plasmid ...
-
bioRxiv - Cell Biology 2019Quote: ... The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397) as a gift from David Liu [31] ...
-
bioRxiv - Biophysics 2021Quote: ... The mEGFP-(L)_pcDNA3.1+ plasmid was obtained by amplifying mEGFP from an mEGFP-N1 vector (a gift from Michael Davidson, Addgene plasmid # 54767) (using a primer encoding a long rigid linker sequence ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The integration of the reporter was performed by co-transfecting 1000 ng TagRFP reporter (5xTetO-pEF-TagRFP-3xNLS) donor plasmid and 500 ng of each TALEN arm (AAVS1-TALEN-L (Addgene #35431) targeting TGTCCCCTCCACCCCACA and AAVS1-TALEN-R (Addgene #35432 ...
-
bioRxiv - Systems Biology 2022Quote: ... into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Biophysics 2022Quote: HEK 293T cells were co-transfected with either pmNG-Mpro-Nter-auto-NLuc or pmNG-Mpro-Nter-auto-L-NLuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (Addgene plasmid # 141370) or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A ...
-
bioRxiv - Biochemistry 2020Quote: ... without start codons and without their native signal peptides identified using SignalP 5.0 with the Gram-positive setting.35 Their open-reading frames were cloned into the expression vector p15TV-L (AddGene ID: 26093) under the T7 promoter and in-frame with the N-terminal 6xHisTag (Twist Bioscience) ...
-
bioRxiv - Biophysics 2021Quote: ... a mp-mEYFP-(L)-mCherry2-(L) construct was first cloned by amplifying mCherry2 from a mCherry2-C1 vector (a gift from Michael Davidson, Addgene plasmid # 54563) and inserting it into mp-mEYFP-(L)_pcDNA3.1+ by digestion with AflII and KpnI ...
-
bioRxiv - Biochemistry 2022Quote: ... The open-reading frames (codon-optimized for expression in E. coli) were cloned into the expression vector p15TV-L (AddGene ID: 26093) under the T7 promoter and in-frame with the N-terminal 6xHisTag (Twist Bioscience) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μl of AAV5-Syn-GCaMP6f-WPRE-SV40 (titre 2.8 × 1013 GC/ml; gift from Douglas Kim & GENIE Project; Addgene viral preparation #100837-AAV5)62 was injected using a microinjection pump (Nanoliter 2010 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were stereotaxically injected under isoflurane anesthesia (1% v/v in oxygen, 1 L/min) with 250 nL of AAV8-hSyn-DIO-hM3d(Gq)-mCherry (Addgene, Catalog # 44361-AAV8) at a rate of 50 nL/min using a 1000 nL Hamilton syringe bilaterally in the dorsal striatum (coordinates ...
-
bioRxiv - Cancer Biology 2023Quote: ... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes with a total volume of 50 μl were prepared in milliQ H2O and contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 or rnt-1 ...