Labshake search
Citations for Addgene :
51 - 100 of 882 citations for HSF2 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... SpCas9 was expressed from pET28a-Cas9-His (Addgene plasmid number 98158) and purified in our lab ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164) were expressed in baculovirus-infected Sf9 insect cells ...
-
bioRxiv - Plant Biology 2024Quote: ... cells harboring the plasmid p2CT-His-MBP-Lbu_C2c2_WT (Addgene No. 83482) were cultivated with 800 ml autoinduction medium (Studier ...
-
bioRxiv - Biophysics 2024Quote: His-tagged TEV protease (pDZ2087, a gift from David Waugh (Addgene plasmid # 92414 ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Biochemistry 2019Quote: ... pMAL-his-LbCpf1-EC was a gift from Jin-Soo Kim (Addgene plasmid # 79008 ...
-
bioRxiv - Biochemistry 2021Quote: The plasmid SARS-CoV-2 3xFlag-His-nsp5CS-nsp15 (Addgene ID: 169166) was used to express 3xFlag-His-nsp5CS-nsp15 in baculovirus-infected insect cells (Supplementary Table S1 and S2) ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid for expression of EPS15-GFP-His was obtained from Addgene (#170860). EPS15D177S was generated using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Biochemistry 2022Quote: pQE-60 roGFP2-His was a gift from Tobias Dick (Addgene #65046)(50) ...
-
LRBA balances antigen presentation and T-cell responses via autophagy by binding to PIK3R4 and FYCO1bioRxiv - Immunology 2024Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid for expression of His-ULP1 was from Addgene (Plasmid #64697), the His-Sortase plasmid was created as previously described 4 ...
-
bioRxiv - Cell Biology 2020Quote: ... human KLF4 (RRID:Addgene_17219), human c-MYC (RRID:Addgene_17220 ...
-
bioRxiv - Cell Biology 2020Quote: ... human SOX2 (RRID:Addgene_17218), human KLF4 (RRID:Addgene_17219) ...
-
bioRxiv - Neuroscience 2022Quote: ... human DNAJB4 (Addgene) and DNAJB6 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... human Dynamin2 (#27689) and human AP2μ2 (#27672) were purchased from Addgene. cDNA encoding human AP2β2 (Clone ID ...
-
bioRxiv - Bioengineering 2020Quote: An HSA expression plasmid was obtained from Addgene (ALB-bio-His, Plasmid #52176). E400R and K383D point mutations were introduced to the HSA sequence by the Q5 site-directed mutagenesis kit ...
-
bioRxiv - Biochemistry 2023Quote: ... A plasmid expressing His-TEV-ubiquitin G76C was acquired from Addgene (Watertown, MA) and the protein was purified using Talon beads (Takara Bio Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: The plasmid pet28a-His6-Keap1 for expressing His-KEAP1 was purchased from Addgene (a gift from Yimon Aye ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Biochemistry 2024Quote: Human Drosha isoform 4 and human DGCR8 clones were purchased from Addgene. cDNA encoding different length variants of Drosha were cloned into pFL plasmid and expressed as a N-terminal Dual-strep tag fusion ...
-
bioRxiv - Biophysics 2019Quote: ... human DCX (Addgene #83928), mouse DCLK1 (Transomics #BC133685) ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... human RIPK3 (Addgene #78804), mouse RIPK1 (Addgene #115341) ...
-
bioRxiv - Cell Biology 2020Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol (Tropea et al. ...
-
bioRxiv - Bioengineering 2019Quote: ... TGFB1-bio-His (proTGFβ) which was a gift from Gavin Wright (Addgene plasmid # 52185) [17] and HA-OVOL2 (OVOL2 ...
-
bioRxiv - Cell Biology 2019Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol(Tropea et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... V5/His-tagged pLenti-puro-LacZ and pLenti-puro-ARID1A were obtained from Addgene.
-
bioRxiv - Biochemistry 2022Quote: ... pET29b-IPP1-His was a gift from Sebastian Maerkl & Takuya Ueda (Addgene plasmid # 124137). 15µL of Lemo21(DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... coli MG1655 into a His-SUMO-TEV (HST) plasmid backbone (Addgene product number: 48313). Each HST construct was grown in LB to an OD600 of 0.4 at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... C-terminal His-tagged eGFP plasmid was from our lab stock (Addgene, No. 178422)32 ...
-
bioRxiv - Cell Biology 2023Quote: ... purified from bacteria cells transformed with the plasmid pET-28b-RfxCas13d-His (Addgene 141322), was kindly provided by JP Concordet ...
-
bioRxiv - Biochemistry 2023Quote: GST-HRAS and His/MBP-KRAS were purchased from Addgene (#55653 and # 159546, respectively). GST-KRAS was created with standard Gibson Assembly (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... pAAV_hsyn_NES-his-CAMPARI2-F391W-WPRE-SV40 was a gift from Eric Schreiter (Addgene plasmid # 101061)31 ...
-
bioRxiv - Molecular Biology 2020Quote: ... His-tagged wild-type and D135S AlkB plasmids were obtained from Addgene (#79050 and #79051) and proteins were purified by a Ni-NTA column followed by cation exchange ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: A plasmid encoding obligate dimeric TGT was cloned from the TGT-His plasmid (Addgene #138201) using DNA HiFi Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... A1AT/ SERPINA1 and PAI1/ SERPINE1 cDNAs were amplified from SERPINA-bio-His plasmid (Addgene #52182) and SERPINE1-bio-his (Addgene #52077 ...
-
bioRxiv - Molecular Biology 2020Quote: ... strains of interest were transformed with a plasmid containing His-tagged SUMO (Smt3-Hisx7) (Addgene) under the control of a copper inducible promoter ...
-
bioRxiv - Cell Biology 2021Quote: ... from the pcDNA3.1 Flag-His-ATM plasmid (kind gift of Michael Kastan; Addgene plasmid #31985) (67 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Pathology 2024Quote: ... BL21(DE3)-RIL Escherichia coli cells were transformed with pJ4M-TDP43-MBP-His (Addgene 104480) and grown on LB/Kanamycin/Chloramphenicol plates then used to inoculate 2L of TB/Kan/Cam/2g dextrose ...
-
bioRxiv - Neuroscience 2023Quote: ... and the injections of AAV5-hSyn-NES-his-CaMPARI2-WPRE-SV40 (2.5x10^12gc/ml Addgene 200nl measured using a Nano Injector ...
-
bioRxiv - Bioengineering 2024Quote: ... For CODE constructs that were built based on the pET-PE2-His backbone (Addgene, #170103), the culture was induced at 18°C for 5 hours followed by 26°C for 14-18 hours ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272 ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...