Labshake search
Citations for Addgene :
51 - 100 of 1845 citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids encoding HA-tagged LRR (leucine-rich-repeat) domains of LRRFIP2 (Addgene plasmid # 21152), and Fli1 (Addgene plasmid # 21151) ...
-
bioRxiv - Genetics 2022Quote: ... The ecDHFR degron domain was amplified from CAG-DDdCas9VP192-T2A-EGFP-ires-puro (Addgene plasmid # 69534 ...
-
bioRxiv - Genomics 2024Quote: Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). Cloning of dCas9 expression plasmid (lenti-dCas9-Blast ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Immunology 2021Quote: The mammalian expression plasmid containing SARS-CoV-2 HexaPro spike was obtained from Addgene (Addgene plasmid # 154754 ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids expressing the SARS-CoV-2 S protein were obtained from Addgene: pcDNA3.3-SARS2-B.1.617.2 (Delta ...
-
bioRxiv - Developmental Biology 2020Quote: The histone acetyltransferase domain from human p300 was subcloned from a published construct (Addgene, 61357) (Hilton et al. ...
-
bioRxiv - Cancer Biology 2019Quote: The mSMO and ShhN (Shh N-terminal domain) plasmids purchased from Addgene (#37673 and #37680). All vectors were propagated in XL10 Gold competent cells ...
-
bioRxiv - Neuroscience 2021Quote: ... mCherry-SH2-mCherry was prepared from the C-terminal SH2 domain of p85a (Addgene #46463). The linker between mCherry and SH2 is SGLRSRAQASNSAVDGTA for the N terminus and GSG for the C terminus.
-
bioRxiv - Cell Biology 2022Quote: ... were transformed with a plasmid encoding the GST-tagged domain of Rhotekin (Addgene plasmid # 15247). Cells were cultivated in Terrific broth (TB ...
-
bioRxiv - Bioengineering 2020Quote: ... KRAB domain was derived from pHAGE EF1α dCas9-KRAB (Addgene 50919, Kearns et al., 2014). VPR complex was derived from lenti-EF1a-dCas9-VPR-Puro (Addgene 99373 ...
-
bioRxiv - Neuroscience 2019Quote: ... was constructed by amplifying the KASH domain from (Addgene 60231, a gift of Feng Zhang) and fusing it (in-frame ...
-
bioRxiv - Microbiology 2023Quote: ... All PNP domains tested for toxicity were cloned into the pBbA6c vector65 (Addgene plasmid # 35290) under the IPTG-inducible pLac promoter.
-
bioRxiv - Genetics 2023Quote: ... and the NLS-Gal4AD domain from a plasmid originally based on pActL-Gal4AD (Addgene 15303) and the 127D01 tag was inserted as part of the primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... and CD28TM CAR domains were amplified from the plasmids pSLCAR-CD19-hCAR-BB (Addgene, #135992) and pSLCAR-CD19-28z (Addgene ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... a 2 mL transfection mixture containing lentiviral packaging plasmids 7.5 µg pMD2.G (#12259, Addgene), 11.4 µg pMDLg-RRE (#12251 ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Immunology 2021Quote: ... C domain coding sequences of human CRT were cloned into the pCMV vector (Addgene plasmid #59314) to generate recombinant constructs with C-terminal Human IgG1Fc (Ig ...
-
bioRxiv - Bioengineering 2021Quote: ... as well as the CD8α hinge and transmembrane domains were cloned into pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene # 12252) or SFG.CNb30_opt.IRES.eGFP (Addgene # 22493 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Spy and Snoop catcher domains were cloned from the pET28a-SpyCatcher-SnoopCatcher plasmid (Addgene, #72324) while the Traptavidin domain came from pET21a-Core-Traptavidin (Addgene ...
-
bioRxiv - Microbiology 2023Quote: pT7-S1/HER2nhd (no head domain) was constructed using pBacT7S1-T3D (Addgene, (Kobayashi et al., 2007) as a backbone plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... The full-length and domain of interest were amplified by PCR using emGFP-BAZ1B (#65372; Addgene) as a template and inserted into pEGFP-C2 vector (Takara Bio ...
-
bioRxiv - Cell Biology 2024Quote: ... NTF2 domain of G3BP1 variants was cloned into a pET28 MBP-TEV bacterial backbone (Addgene, 69929) with Gibson assembly.
-
bioRxiv - Microbiology 2023Quote: ... All other SARS-CoV-2 viral protein-encoding plasmids were obtained from Addgene in the pLVX-EF1a-IRES-puro backbone (Addgene #141367-141370 ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: ... a solution containing two sgRNAs (40 ng/μL each) and Cas9 protein (250 ng/μL) (Addgene; 47327) (Gagnon et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... fragments containing promoter and fusion protein segments were digested and cloned into the pKHR4 vector (Addgene #74592) using SpeI (NEB #R3133 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid expressing the catalytic domain of PKCδ was previously described (Soh and Weinstein, 2003) (Addgene plasmid #16388).
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... EF.deltaBHES1.Ubc.GFP (DBD-HES1 DNA-binding domain mutant of HES1; #24982) were obtained from Addgene (Cambridge, USA). The reporter plasmids containing the firefly luciferase gene under the control of various fragments of the Hes1 promoter (2.5 kb ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...
-
bioRxiv - Microbiology 2021Quote: The Plasmid expressing SARS CoV-2 Spike protein (Wuhan isolate) was procured from Addgene with 19 nineteen amino acids deletion at C- terminal that enables efficient lentiviral packaging ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...
-
Safe plant Hsp90 adjuvants elicit an effective immune response against SARS-CoV2 derived RBD antigenbioRxiv - Molecular Biology 2023Quote: ... pseudo-type lentiviruses coated with the SARS-CoV-2 S protein harboring the vector pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian (Addgene plasmid #145780) were prepared by co-transfecting HEK293T cells with psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Cell Biology 2024Quote: ... For G3BP1 live imaging a GFP-G3BP1 fusion protein containing plasmid (pEGFP-C1-G3BP1-WT, Addgene plasmid # 135997) was transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... and fused in frame with the human ZNF10 KRAB domain (amplified from the pAAVS1-NDi-CRISPRi (Addgene #73498)) or the catalytic domain (CD ...
-
bioRxiv - Genomics 2022Quote: ... dCas9-KRAB domain (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro was a gift from Charles Gersbach (Addgene plasmid # 71236 ...
-
bioRxiv - Cell Biology 2022Quote: ... The RhoA biosensor uses the AnillinAHPH domain (Piekny and Glotzer, 2008) and was obtained from Addgene (plasmid # 68026). The EGFP-AnilinAHPH was sub-cloned into pHR lentiviral backbone using similar sites and strategy as mentioned above ...
-
bioRxiv - Cancer Biology 2022Quote: ... Control and SUZ12 sgRNA targeting the VEFS functional domain were cloned into pL-CRISPR.EFS.Blast (plasmid was generated by replacing tagRFP in Addgene Plasmid #57819 with blasticidin S deaminase antibiotic selection marker ...
-
bioRxiv - Genetics 2022Quote: ... We made the dCas9-TurboID construct by replacing the KRBA domain on Lenti-dCas9-KRAB-blast (Addgene, 89567) with TurboID sequence (Addgene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This receptor harbors a myc-tag on its extracellular domain that can be visualized by immunostaining (Addgene #79128). A second virion expresses both the mCherry reporter and BFP under control of the Tetracycline responsive element (TRE-3G ...