Labshake search
Citations for Addgene :
51 - 100 of 1214 citations for Cow Presenilin Enhancer 2 Homolog C. Elegans PSENEN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Synthetic enhancers were amplified by PCR with primers that included homology to the plasmid vector E1b-GFP-Tol2 (Addgene plasmid #37845)81 and were cloned upstream of the minimal promoter (E1b ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... The hDLXI56i enhancer was originally obtained from CN1851-rAAV-hI56i-minBglobin-iCre-4×2C-WPRE3-BGHpA (Graybuck et al., 2021) (Addgene #164450).
-
bioRxiv - Cancer Biology 2024Quote: ... The promoter- or enhancer-targeting sgRNAs and non-targeting sgRNAs with no genome recognition sites were cloned into LentiGuide-Puro (Addgene: 52963). The cells stably expressing dCas9-KRAB-MeCP2 were infected with these vectors and then selected with puromycin (2 ug/ml ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Neuroscience 2020Quote: ... the promoter was substituted by mDlx enhancer sequence from pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900) and cDNA encoding mCherry was further inserted into multicloning site 21 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Rcho1 cells were stably cotransfected with the vectors (phU6-gRNA) expressing enhancer gRNAs and Cas9 (pLV hUbc-Cas9-T2A-GFP, Addgene, Plasmid #53190)[32] using Lipofectamine 2000 transfection reagent (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vectors of the full-length SARS-CoV-2 spike and the human serine protease TMPRSS2 with a C-terminal C9-tag (TETSQVAPA) were acquired from AddGene (Summit Pharmaceutical International ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-N-BE(2)-C cells were transduced with lentiviral constructs for stable expression of the different tested RRM2 promotor targeting sgRNAs (Addgene) (MP-I-1142 sg86RRM2 ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Microbiology 2019Quote: ... cells in BHIS were recovered at 37°C for 1.5-2 hours if using a replicative plasmid (pLI50, a gift from Chia Lee, Addgene plasmid #13573) and at 28°C for 4 hours if using a temperature-sensitive plasmid (pIMAY ...
-
bioRxiv - Cell Biology 2020Quote: hCIB2 was subcloned into pET21a (histidine tag on the C-terminus; hCIB2-6xHis) and GST-Rheb in pGEX-4T-2 (Addgene #15889), transformed in Bl2 (DE3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Bioengineering 2021Quote: ... the sequence encoding the PE2 C terminus (PE2-C term) (Addgene #132775), and the WPRE sequence (Addgene #52962 ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806 ...
-
bioRxiv - Biochemistry 2020Quote: ... pDEST26-C-FLAG (Addgene #79275) [22] vector ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and c-Met (Addgene; 31784) plasmids were purchased from Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pOPARA2 or pPGC-C (Addgene plasmid # 174580 ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... NM_018344.6 (SLC29A3):c.1427A>G (p.Ter476Trp) and NM_000343.4(SLC5A1):c.1993T>C (p.Ter665Arg)) were cloned into pCDNA3.1-HA (Addgene 128034) using Gibson assembly ...
-
bioRxiv - Cell Biology 2021Quote: ... pMXs-c-Myc (Addgene Plasmid #13375) per 10 cm dish using Fugene 6 (Catalog# Promega# E2691) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pT3-EF1a-c-Met (31784, Addgene) or pCMV-Hygro-LINC01510 (Twist Bioscience ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-C-18 (Addgene #53978), and mApple-paxillin-22 (Addgene #54935) ...
-
bioRxiv - Cell Biology 2020Quote: ... mCardinal-H2B-C-10 (Addgene #56162)11 ...
-
bioRxiv - Cancer Biology 2022Quote: mCherry-Lamin A/C (Addgene #55068) and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Biochemistry 2021Quote: ... C-terminal MBP plus His6 (Addgene_37237); N-terminal His6 plus glutathione S-transferase (GST ...
-
bioRxiv - Cancer Biology 2021Quote: ... or C-Flag-Rela (Addgene #20012) using 25μL Lipofectamine and 4.5μg plasmid DNA in 600μL Optimem total ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Plant Biology 2020Quote: ... or pAG426GAL_ccdB_eGFP (Addgene; C-terminal GFP fusion).
-
bioRxiv - Plant Biology 2019Quote: ... a C-terminal 3xFLAG epitope (AddGene #50308) and a Nos-terminator (AddGene #50266 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry-Histone H2B-C-10 (Addgene #55057), and mCherry-LAMINB1-10 (Plasmid #55069 ...
-
bioRxiv - Immunology 2021Quote: ... pMIEG3-c-Jun and pMIEG3-JunB (Addgene #116747 ...
-
bioRxiv - Immunology 2020Quote: ... mCherry-Dectin1A-C-10 (Addgene plasmid # 55025), and mCherry-Dectin1A-N-10 (Addgene plasmid # 55026 ...
-
bioRxiv - Immunology 2020Quote: ... Emerald-Dectin1A-C-10 (Addgene plasmid # 54057), mCherry-Dectin1A-C-10 (Addgene plasmid # 55025) ...
-
bioRxiv - Neuroscience 2022Quote: ... and pMXs-c-MYC (Addgene, Cambridge, MA) as reported previously77 ...
-
bioRxiv - Neuroscience 2021Quote: ... Figs. 4A-C, 5, and 7B,C, and Supplementary Movies 1,2; Salk Vector Core; 2.5 x 1012; Addgene plasmid #50973); AAV1-hSyn-SIO-stGtACR2-FusionRed (Fig ...