Labshake search
Citations for Addgene :
51 - 100 of 696 citations for Cortisol ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... was PCR amplified and cloned downstream of EGFP in the pAc5.1B-EGFP vector (a gift from Elisa Izaurralde; Addgene plasmid #21181) using the HindIII and EcoRI restriction sites to make pAcB5.1-EGFP-FMRP ...
-
bioRxiv - Bioengineering 2020Quote: ... sgRNA targeting TP53 gene exon 5 (5’-GTTGATTCCACACCCCC.GCCcgg-3’) was cloned into lentiGuide-Puro vector (Addgene, #52963), named lentiGuide-Puro_e5.2 ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964). AAV2/9 ...
-
bioRxiv - Neuroscience 2020Quote: ... and the helper pAAV2/5 (Addgene #104964), pAAV2/8 (Addgene #112864) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 μg pCL-Eco (#12371, Addgene) in Opti-MEM with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... 5 µg of psPax2 (Addgene, Cat# 12260), and 2 µg of pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg envelope plasmid pMD2.G (Addgene), and 20 µg transfer plasmid (pTRIPZ ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (for AAV5; Addgene plasmid # 104964), or pAAV2/9n (for AAV9 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5-GfAABC1D-hM3Dg-mCherry (Addgene; RRID:Addgene_50478), AAV-CMV-Aldh1a1-shRNA (Stanford ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5-GfAABC1D-hM3Dg-mCherry (Addgene; RRID:Addgene_50478), AAV-CMV-Aldh1a1-shRNA (Stanford ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1/5-CamKIIahChR2(H134R)-eYFP or AAV1/5-CamKIIa-eYFP (AAV5: from UNC GTC Vectore Core; AAV1: from Addgene) was injected bilaterally in mPFC under stereotaxic guidance at 2.2 mm anterior and 0.3 mm lateral to bregma and 1.6 mm ventral to the skull ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Systems Biology 2019Quote: ... A20-targeting guide RNAs (5’ – CACCGTTTGCTACGACACTCGGAAC – 3’, and 5’ – CACCGCTCGGAACTTTAAATTCCGC – 3’) were cloned into lentiCRISPR v2 (Addgene Plasmid #52961)48 and used for lentivirus production in HEK293T cells ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 µl of pre-diluted AAV8-p4BDNF-ERT2CreERT2 was mixed with 5 µl of AAV8-CAG-FLEX-tdTomato (Addgene) and 5 µl of AAV1-hSyn-eGFP-WPRE-bGH (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Developmental Biology 2019Quote: ... Two oligos encoding guide RNA sequences that targeted either exon 3 (5’-GGCTTCGACAAGGCCGAGGG −3’) or exon 4 (5’-GATCTGATCACGACGTGTTA −3’) were inserted into the BbsI site of pU6-BbSI-gRNA (Addgene). Each gRNA construct was independently injected into BDSC Stock 52669 (y1 M{vas-Cas9.S}ZH-2A w1118 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... the guide RNA targeting HDAC6 exon 5 (5’-GAAAGGACACGCAGCGATCT-3’) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961). The HDAC6-KO vector can also express the codon-optimized Cas9 protein as well as puromycin resistance gene ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg pT3 EF1a-MYC (Addgene plasmid # 92046) and 1 μg CMV-SB10 (Addgene plasmid # 24551 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’-entry vector pENTR5’-ubi (ubiquitin promoter) (Addgene plasmid #27230 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 µg VSV-G (pMD2.G, Addgene #12259) and 3.3 µg of plasmid of interest ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Glut2 in pX330S-5 (Plasmid #58781, Addgene). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg AAVS1-TALEN L plasmid (Addgene #59025), and 5mg donor plasmid (AAVS1 TREG EBdCas9 or AAVS1 TREG EBNCdCas9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of packaging plasmids psPAX2 (Addgene, #12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... pMDLg/pRRE (Addgene 658-5, 12259, 12251, 12253) to generate lentiviruses expressing ANDV or TULV N proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5-hSyn-DIO-EGFP (Addgene # 50457-AAV5) or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of plasmid Δ8.2 (Plasmid #8455, Addgene), and 3 μg of plasmid VSVG (Plasmid #8454 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg packaging plasmid pUMVC (Addgene, Plasmid #8449), 6.5 μg envelope plasmid pCMV-VSV-G (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μg/flask of psPAX2 (Addgene 12260) using EndoFectin Lenti transfection reagent (GeneCopoeia ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5-FLEX-EGFPL10a was purchased from Addgene. The final titers of these viral vectors were estimated to be 1013 genome copies per milliliter ...