Labshake search
Citations for Addgene :
51 - 100 of 807 citations for 9 3 bromophenyl 9 phenyl 9H fluorene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL, Addgene, 108685) was injected into the MLT (from the bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... and chemogenetic experiments: AAV1/9 CAG FLEX GCaMP6f (titre 1.9x1013, Addgene # 100836-AAV1), AAV9.CamKII.GCaMP6s (titre ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 nL of AAV2/9-hSyn-GCaMP6s (Addgene, titer ≥ 1×1013 vg/mL) was pressure injected into each ocular vitreous through a glass micropipette using a Nanoject (Drumond Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-EF1a-DIO-EYFP viral particles (0.8μl; 1013 GC/ml; Addgene #27056) were injected bilaterally into the CA1 hippocampus (coordinates relative to bregma ...
-
bioRxiv - Neuroscience 2024Quote: We used the following viruses and tracers: AAV2/9-syn-jGCaMP8s-WPRE (Addgene), AAVrg-PGK-Cre (Addgene) ...
-
bioRxiv - Neuroscience 2024Quote: ... with three plasmids (helper [Addgene plasmid number: 112867], AAV2/9 rep/cap [Addgene plasmid number ...
-
bioRxiv - Developmental Biology 2021Quote: ... The gRNA expression vectors were constructed using a Cas-9 sgRNA vector (Addgene, #68463) as a backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21(DE3) expression strains containing GST-Hsp90 N(9–236) plasmid (Addgene: 22481) were grown in 1 l LB media supplemented with 100 μg/ml ampicillin at 25 °C and shaking (200 r.p.m. ...
-
bioRxiv - Neuroscience 2023Quote: Viruses used in this study include: AAV2/9.Syn.Flex.GCaMP6f.WPRE.SV40 (1E+13 Addgene 100833 – 100nl), AAV2/1-CAG-FLEX-rev-ChR2-tdtomato (1.23E+13 gc/mL – Boston Children’s Hospital Viral Core – 125nl) ...
-
bioRxiv - Neuroscience 2024Quote: ... whereas AAV2/9 vectors containing the RAM system (titer 3.39E13) were purchased from AddGene. Each vector was mixed with an infection marker virus AAV2/9-CB7/mCherry (titer 1.50E13 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/9 particles were bilaterally injected to express PDE4A isoforms or GFP (Addgene #50469) in the hippocampal excitatory neurons using the CaMKII promoter ...
-
bioRxiv - Neuroscience 2024Quote: ... and one of the following packaging plasmids: pAAV2/9 (Addgene, Watertown, MA, USA, 112865), pAAV2/hu32 ...
-
bioRxiv - Cell Biology 2021Quote: ... then cells were transfected with 9 µg of each of pMXs-Oct4 (Addgene Plasmid #13366), pMXs-Sox2 (Addgene Plasmid #13367) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors containing Cre-inducible GCaMP6f (AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40, Addgene; TIter≥2.1×13 GC/ml) were injected into the right DLS or DMS by stereotaxic surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... we delivered GCaMP6f under control of the synapsin promoter (AAV1/9-SYN-GCaMP6f; Addgene, #100837)51 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/9 (University of Pennsylvania Gene Therapy Program Vector Core) or pAAV2/retro (#81070; Addgene), trans plasmid ...
-
bioRxiv - Bioengineering 2024Quote: For transgene expression studies with AAV vectors we used the following AAV expression plasmid:pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA was a gift from Hirokazu Hirai (Addgene plasmid # 190163 ...
-
bioRxiv - Neuroscience 2021Quote: ... under a flex promoter was obtained from the University of Pennsylvania Vector Core (AAV2/9.Syn.Flex.GCaMP6f.WPRE.SV40, CS0641, Penn Vector Core via Addgene). Lateral septum viral injections were targeted at the following coordinates ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Microbiology 2020Quote: ... CRISPR/Cas-9 vectors were derived from the plasmid lentiCRISPRv2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ; http://n2t.net/addgene:12260; RRID:Addgene_12260), and 3 µg of pCAGGS-S (SARS-CoV-2)(Catalog No ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-9 20 nL injections of AAV1-Syn-flex-GCaMP6s (Addgene #100845-AAV1, Chen et al., 2013) were delivered to the RSC (AP ...
-
bioRxiv - Biochemistry 2020Quote: ... and for luciferase assays a ratio of 1:9:10 HA-Clover plasmid:pcDNA(-):HRE-Luciferase (Addgene #26731) was used (physiological expression levels) ...
-
bioRxiv - Neuroscience 2022Quote: ... versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459; titer: 9 × 1012 gc/ml). To ablate PVNOT neurons ...
-
bioRxiv - Neuroscience 2024Quote: The plasmid WPRE-ab (pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA) was obtained from previous studies in our laboratory (Addgene plasmid #190163). The plasmid CAG-eYFP-3x-miR708-5p-TS was a gift from Viviana Gradinaru (Addgene plasmid #117381 ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083; http://n2t.net/addgene:36083; RRID:Addgene_36083), 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2020Quote: ... H357 and SCC-9 cells were transfected with RRBP1 overexpression plasmids pcDNA4 HisMax-V5-GFP-RRBP1(Addgene:Cat#92150) using the ViaFect transfection reagent (Promega Cat# E4982) ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-Ef1a-DIO hChR2 (E123T/T159C)-EYFP (gift from Karl Deisseroth, packaged into AAV serotype 9 from Addgene, plasmid # 35509 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells (between passage 9-11) were transfected with lentiviral packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Microbiology 2022Quote: ... PCDNA3-GFP1-9 T2A mCherry was a gift from Xiaokun Shu (Addgene plasmid # 124430;http://n2t.net/addgene:124430; RRID:Addgene_124430) (PMID ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Immunology 2022Quote: ... RAW 264.7 macrophages were transduced with lentiviral particles containing Gal-9-3xFLAG expressed from pLenti-puro (Addgene #39481). Primary murine bone marrow-derived macrophages (BMMs ...
-
bioRxiv - Neuroscience 2024Quote: ... We used the following viral constructs and injection volumes per site in the different types of experiments: AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40 (calcium recordings 140 nl; Addgene, no. 100833); AAV.1.hSyn.dio.EGFP (anterograde labelling ...
-
bioRxiv - Neuroscience 2021Quote: ... We bilaterally injected 368 nl of AAV2/9 hSyn.hChR2(H134R).eYFP.WPRE.hGH (UPenn Vector Core) or AAV2/9 CaMKII.ArchT-GFP (UNC Vector Core) or pGP-AAV-syn-jGCaMP7f-WPRE (Addgene) to the LEC or MEC ...
-
bioRxiv - Microbiology 2021Quote: ... the TEV FlipGFP plasmid PCDNA3-FlipGFP(TEV cleavage seq) T2A mCherry (Addgene, #124429, a gift from Xiaokun Shu [9]) was used as a template for pairs of PCR reactions including primers designed to generate overlapping products replacing the TEV cleavage site with the indicated cleavage sequence (S9 Table) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected either rAAV2/9 encoding GCaMP6s (Chen et al., 2013) under control of the CaMKII promoter (1.25 × 1013 gc/ml; AddGene viral prep #107790-AAV9 ...
-
bioRxiv - Neuroscience 2022Quote: ... or rAAV2/9 encoding for NIR-GECO2 under control of the synthetic CAG promoter (0.5 × 1012 -1 × 1013 gc/ml; AddGene plasmid #159603 ...
-
bioRxiv - Neuroscience 2022Quote: ... PV mice (n=9) were infused with AAV9-CAG-FLEX-SomArchon-GFP (titer: 6.3×1012 – 1.1×1013 GC/mL, Addgene #126943) or AAV9-synapsin-FLEX-SomArchon-GFP (titer ...
-
bioRxiv - Microbiology 2020Quote: ... were plated in a 100-mm tissue culture dish and transfected the next day when they were about 75% confluent with a combination of the following plasmids: 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083 ...
-
bioRxiv - Neuroscience 2022Quote: ... between the age of P60 and P120 (n = 6) were injected with virally encoded Cre-dependent GCaMP in PFC (~300 nl, AAV2/9 flex GCaMP6f, Addgene) and Cre in LEC (140 nl at each site ...
-
bioRxiv - Neuroscience 2021Quote: Cre-dependent adeno-associated virus (AAV; serotypes 5 or 9) was used to express GCaMP6s (AAV5-Syn-Flex-GCaMP6s, Addgene), or GCaMP7f (AAV9-Syn-Flex-jGCaMP7f-WPRE ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.1 μL of adeno-associated virus serotype 9 (AAV9) carrying GCaMP6f under the excitatory neuronal promoter CaMKII (AAV-CaMKII-GCaMP6f) (Addgene) to co-transfect the TRPV1 and GCaMP6f into neurons.
-
bioRxiv - Neuroscience 2023Quote: ... University of Zurich (purified by VVF as v723-9; AAV9-hCMV-HA-SpCas9, Addgene 106431, gift from Juan Belmonte [22]).
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-EF1a-SaCas9-P2A-HA produced from the plasmid pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA (Addgene #113688) (46) ...
-
bioRxiv - Plant Biology 2024Quote: ... the constructs encoding S10-tagged and S11-tagged protein fusions were co-expressed in the presence of UBQ10:sXVE: GFP1–9 (Addgene plasmid # 108187 ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN neurons - AAV-9: pGP-AAV-syn-GCaMP6s-WPRE.4.641 at a titre of 1×1013 GC·ml- 1 (Addgene, Watertown, MA, USA);
-
Targeting Noradrenergic Neurons of the Locus Coeruleus: A Comparison of Model Systems and StrategiesbioRxiv - Neuroscience 2022Quote: ... Injections of rAAV2/9-Ef1a-DO-DIO-tdTomato-eGFP (2.3 × 1013 gc/ml; kindly gifted from Bernardo Sabatini; AddGene plasmid #37120)34 were performed in TH- and DBH-cre animals to estimate the viral spread ...