Labshake search
Citations for Addgene :
51 - 100 of 2063 citations for 8 phenylamino 5 4 5 sulpho 1 naphthyl azo 1 naphthyl azo naphthalene 1 sulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9; http://n2t.net/addgene:100833; RRID:Addgene_100833). pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077) and electroporated using the Neon System (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Immunology 2021Quote: ... par-5 and his-1 cDNA were subcloned into pCE-BiFC-VN173 and pCE-BiFC-VC155 plasmids (Addgene, Cambridge, MA), which contain the heat shock promoter Phsp-16.41 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Cell Biology 2022Quote: ... a 20bp guide sequence targeting the 5’ end of WNK1 exon 1 was ligated to the BbsI site of PX459 (Addgene #62988). In addition ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Biochemistry 2019Quote: ... and pFLAG-SREBP2Nt (N-terminal transcriptionally active domain, amino acids 1-482) (Addgene, 26807) were used to transfect cells (HEK293) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.25 μL of F-ABM lentiviral mix (1:1:1:1 of Addgene plasmids 27150 ...
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of each plasmid pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (Addgene #27078) ...
-
bioRxiv - Neuroscience 2023Quote: PV-IRES-Cre mice were injected with AAV2/8.CAG.Flex.eGFP (Addgene, titer ≥ 1×10¹³ vg/mL) anterograde tracing virus in the HDB (antero-posterior ...
-
bioRxiv - Neuroscience 2023Quote: ... Addgene #55639 (packaged in AAV2/1) AAV2/8-EF1a-fDIO-ChrimsonR-mRuby2-KV2.1TS modified from Addgene #124603 pAAV-hSyn1-SIO-stGtACR2-FusionRed ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 1:1 with pAAV.CAMKII.Cre.SV40 (#105558; Addgene), or pAAV.CAG.GFPsm-myc.WPRE.SV40 (#98926 ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537 ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Biochemistry 2024Quote: ... a ∼1:1:1 molar ratio mixture of library transfer (lentiCRISPRv2; Addgene plasmid #52961) and packaging plasmids (psPAX2 ...
-
bioRxiv - Neuroscience 2021Quote: ... DJ-1 (pGEX-5X-1-DJ1-WT; Addgene) or pcDNA plus RFP plasmid(57 ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Immunology 2021Quote: ... and a separate master mix was prepared comprising 1 mL Opti-MEM 8 µg PSPAX (12260, Addgene, Watertown, MA), 2 µg PMD2G plasmids (12259 ...