Labshake search
Citations for Addgene :
51 - 100 of 2985 citations for 7 Diethylamino 3 nitro 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Biophysics 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was a gift from Jason McLellan (7) and obtained from Addgene (plasmid #154754 ...
-
bioRxiv - Molecular Biology 2020Quote: ... These cells were spin transfected for 2h at 1000g with 82*10E6 Brunello virus particles (LentiCRISPRv2, Addgene 73179-LV ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cell Biology 2019Quote: mPlum-Lifeact-7 (Addgene plasmid # 54679) and mCherry-Sec61 β (Addgene plasmid # 49155 ...
-
bioRxiv - Neuroscience 2020Quote: ... or mCherry-Mito-7 (Addgene #55102) (34 ...
-
bioRxiv - Neuroscience 2021Quote: The plasmid pT7-7 (Addgene 36046)[29] coding for the human α-synuclein wild type (α-syn ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pmTagBFP2-Lifeact-7 (Addgene plasmid #54602) from M ...
-
bioRxiv - Cell Biology 2022Quote: ... mTagRFP-T2-Mito-7 (Addgene #58041) (referred to as mitoRFP in the text) ...
-
bioRxiv - Bioengineering 2024Quote: ... mCherry-Rab4a-7 (Addgene plasmid # 55125) and mCherry-Rab11a-7 (Addgene plasmid # 55124 ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... An all-in-one Cas9/gRNA expression construct by cloning an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene #129727) downstream of the hU6 promoter in a PX458 (Addgene #48138 ...
-
bioRxiv - Bioengineering 2024Quote: An all-in-one Cas9/gRNA expression construct encoding an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene; 129727) was placed downstream of the hU6 promoter in a PX458 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid mEGFP- lifeact-7 (Addgene # 54610) was a gift from Michael Davidson and Lamp1-mGFP (Addgene # 34831 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid #54560) were gifted by Michael Davidson ...
-
bioRxiv - Cell Biology 2021Quote: ... 7 and 8 were ordered from Addgene. The plasmids ordered were HDAC2 Flag (Addgene plasmid # 36829 ...
-
bioRxiv - Cell Biology 2021Quote: ... and td-Tomato-LifeAct 7 (Addgene 54528).
-
bioRxiv - Microbiology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid#54560) were gifted by Michael Davidson ...
-
bioRxiv - Microbiology 2022Quote: ... 7 μg of pMD2.G (Addgene # 12259), and 11 μg of pMDLg/pRRE (Addgene # 12251 ...
-
bioRxiv - Cell Biology 2023Quote: ... and mTagBFP2-Lifeact-7 (Addgene plasmid #54602)69 from Dr ...
-
bioRxiv - Bioengineering 2024Quote: ... and mCherry-Rab11a-7 (Addgene plasmid # 55124) were gifts from Michael Davidson ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP1-10 and GFP11×7 fragments were obtained from plasmids pcDNA3.1-GFP(1-10) (Addgene: 70219) and pACUH-GFP11×7-mCherry-α-tubulin (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Neuroscience 2023Quote: ... one plasmid (px458, Addgene Plasmid #48138) expressing sgRNA as well as Cas9 was used to introduce double-strand-breaks near Exon 7 of SMN2 locus ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Microbiology 2023Quote: ... One copy of mKate2 (Addgene #68441) was fused to a strong promoter from the Anderson collection (Table 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Neuroscience 2023Quote: Trh-Cre mice of age 2-3 months were injected with AAV1-hSyn-Flex-GCaMP6s (Addgene, 100845). More than 3 weeks after surgery ...
-
bioRxiv - Neuroscience 2024Quote: ... An intersectional approach was used for selective activation of mPFC to BLA projection using chemogenetics: 1) retrograde AAV encoding FlpO (0.3 μL, titer ≥ 7 x 1012 GC/ml, Addgene# 55637; RRID:Addgene_55637) were bilaterally injected into BLA (A-P ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cell Biology 2022Quote: ... and mEmerald-Nucleus-7 (Addgene plasmid no. 54206) were gifts from Michael Davidson (Florida State University) ...
-
bioRxiv - Biophysics 2019Quote: ... plasmid EGFP-Actin-7 from Addgene (ref 56421) was used with the electroporation program Amaxa T20.
-
bioRxiv - Cell Biology 2020Quote: ... and to link GFP11×7 tag (from Addgene Plasmid #70224 ...
-
bioRxiv - Cancer Biology 2020Quote: ... with lentiviral packaging vectors psPAX2 (7 μg; Addgene) and pMD2.G (3,5 μg ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 μg Cas9 nuclease plasmid (pX459, Addgene #62988) 1.4 μg pPN298 and 1.4 μg pPN306 were electroporated into 2.5×106 cells at 1050V ...