Labshake search
Citations for Addgene :
51 - 100 of 1938 citations for 6 Diazo 5 6 dihydro 5 oxo 1 naphthalenesulfonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Cell Biology 2020Quote: ... YFP-Parkin was a gift from Richard Youle (Addgene plasmid #23955)6 and EGFP-LC3 was a gift from Karla Kirkegaard (Addgene plasmid #11546)7 ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Genomics 2020Quote: ... EF06R (5’UTR-LINE-1) was a gift from Eline Luning Prak (Addgene plasmid # 42940 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV1-hSyn-Cre-WPRE-hGH (Addgene, 10^13 gc/ml, diluted 1:5), AAV5-CAG-FLEX-tdtomato (UNC Viral Core ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 μg of CS2-plasmid containing the ORF for Cas9 (Addgene #51307) or H2B-RFP was linearized by Not1 endonuclease digestion ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9 ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed at a 5:1 ratio with pCMV(CAT)T7-SB100 (Addgene #34879), and co-transfected to HEK293T cells using TransIT-293 (Mirus) ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...
-
bioRxiv - Biophysics 2022Quote: ATG12–5-16L1-GFP constructs (Addgene_169077) were expressed and purified from SF9 cells as described25 (dx.doi.org/10.17504/protocols.io.br6qm9dw) ...
-
bioRxiv - Immunology 2019Quote: ... pCMV-DR8.2 (5 ng, Addgene #12263) and 2.5 μg of the lentiviral vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of VSV.G (#14888, Addgene) and 5 μg pCL-Eco (#12371 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg pMD2G (12259; Addgene) using Lipofectamine 2000 according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Bioengineering 2020Quote: ... sgRNA targeting TP53 gene exon 5 (5’-GTTGATTCCACACCCCC.GCCcgg-3’) was cloned into lentiGuide-Puro vector (Addgene, #52963), named lentiGuide-Puro_e5.2 ...
-
bioRxiv - Neuroscience 2021Quote: pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (titer ≥ 1×1013 vg/ml, working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9 ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319; http://n2t.net/addgene:54319; RRID: Addgene_54319) and mCherry-Paxillin-22 (Addgene plasmid # 55114 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-hSyn-DIO-mCherry (control, titer 6 × 1012 cfu/ml, 250nl bilateral, #50459, Addgene), AAV5-hSyn-GFP-Cre (titer 3.5 × 1012 cfu/ml ...