Labshake search
Citations for Addgene :
51 - 100 of 1864 citations for 6 Chloro 9 3 N 2 chloroethyl ethylamino propylamino 2 methoxyacridine dihydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... PV mice (n=9) were infused with AAV9-CAG-FLEX-SomArchon-GFP (titer: 6.3×1012 – 1.1×1013 GC/mL, Addgene #126943) or AAV9-synapsin-FLEX-SomArchon-GFP (titer ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Neuroscience 2023Quote: Trh-Cre mice of age 2-3 months were injected with AAV1-hSyn-Flex-GCaMP6s (Addgene, 100845). More than 3 weeks after surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Biophysics 2022Quote: ... NCBI Accession YP_009820873.1) were cloned with an N-terminal TEV protease-cleavable His6-tag using UC Berkeley Macrolab vector 2-BT (Addgene #29666). Truncations and other modified constructs were cloned by PCR mutagenesis and isothermal assembly ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mammalian expression vector for St1Cas9 (LMD-9) fused to SV40 NLS sequences at the N- and C-terminus (MSP1594_2x_NLS; Addgene plasmid #110625) was constructed from MSP1594 (Kleinstiver et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA#2: 5’-aacctgagtgatatgactag-3’) were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Biophysics 2022Quote: ... The following expression vectors were used for plasmid DNA transfections: pCMV-mEmerald-FilaminA-N-9 (Addgene #54098, gift from Michael Davidson), pCMV-mCherry-FilaminA-N-9 (Addgene #55047 ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 x 105 HeLa cells were seeded into a 6-well plate and next day transfected with 2 μg of the FLPe recombinase plasmid (Addgene #20733) (Beard et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Systems Biology 2019Quote: ... 350k HAP1 WT cells were seeded into a 6-well plate and 24 hours later cells were transfected with a mix of 2 µg pX459 plasmid (Addgene #62988) carrying a gRNA ...
-
bioRxiv - Genetics 2020Quote: ... a single guide sequence (primers JBW0001/2) targeting MSH2 exon 6 was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) as described24 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #2 (TRCN0000284998, Addgene #136585), shJUND #1 (TRCN0000416347 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #2 (TRCN0000416920, Addgene #136583).
-
bioRxiv - Genomics 2019Quote: ... pMDG.2 (3.2µg; Addgene #12259), TKOv3 plasmid library (8µg) ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg psPAX2 (Addgene #12260), 2 μg pMD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/9 (Addgene #112865), or rAAV2-retro (Addgene #81070 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV2/1.ef1a.fDIO.GCaMP6s (Janelia Vector Core) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV1.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/9 (Addgene #112865), or pUCmini-iCAP-PHP.eB (Addgene #103005) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/9 (Addgene #112865), pAAV-hSyn-Cre (Addgene #170367)61 ...
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were seeded at 80% density in a 10-cm tissue cell culture treated dish and transfected with the 6 µg of expression plasmid and packaging plasmids 2 µg of pMD2.G (Addgene, cat# 12259) and 4 µg of psPAX2 (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...