Labshake search
Citations for Addgene :
51 - 100 of 844 citations for 3 Chloro phenyl 9H fluoren 9 ylmethoxycarbonylamino acetic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and chemogenetic experiments: AAV1/9 CAG FLEX GCaMP6f (titre 1.9x1013, Addgene # 100836-AAV1), AAV9.CamKII.GCaMP6s (titre ...
-
bioRxiv - Bioengineering 2024Quote: ... pFA6a-link-yoEGFP-SpHis5 (primers OM-8 and OM-9) (Addgene plasmid #44836), and pBTK522::FAST-PETase 21 (gift from Hal Alper ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 nL of AAV2/9-hSyn-GCaMP6s (Addgene, titer ≥ 1×1013 vg/mL) was pressure injected into each ocular vitreous through a glass micropipette using a Nanoject (Drumond Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL, Addgene, 108685) was injected into the MLT (from the bregma ...
-
bioRxiv - Neuroscience 2024Quote: ... with three plasmids (helper [Addgene plasmid number: 112867], AAV2/9 rep/cap [Addgene plasmid number ...
-
bioRxiv - Neuroscience 2024Quote: We used the following viruses and tracers: AAV2/9-syn-jGCaMP8s-WPRE (Addgene), AAVrg-PGK-Cre (Addgene) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The gRNA expression vectors were constructed using a Cas-9 sgRNA vector (Addgene, #68463) as a backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Neuroscience 2023Quote: Viruses used in this study include: AAV2/9.Syn.Flex.GCaMP6f.WPRE.SV40 (1E+13 Addgene 100833 – 100nl), AAV2/1-CAG-FLEX-rev-ChR2-tdtomato (1.23E+13 gc/mL – Boston Children’s Hospital Viral Core – 125nl) ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21(DE3) expression strains containing GST-Hsp90 N(9–236) plasmid (Addgene: 22481) were grown in 1 l LB media supplemented with 100 μg/ml ampicillin at 25 °C and shaking (200 r.p.m. ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/9 particles were bilaterally injected to express PDE4A isoforms or GFP (Addgene #50469) in the hippocampal excitatory neurons using the CaMKII promoter ...
-
bioRxiv - Neuroscience 2024Quote: ... whereas AAV2/9 vectors containing the RAM system (titer 3.39E13) were purchased from AddGene. Each vector was mixed with an infection marker virus AAV2/9-CB7/mCherry (titer 1.50E13 ...
-
bioRxiv - Neuroscience 2024Quote: ... and one of the following packaging plasmids: pAAV2/9 (Addgene, Watertown, MA, USA, 112865), pAAV2/hu32 ...
-
bioRxiv - Cell Biology 2021Quote: ... then cells were transfected with 9 µg of each of pMXs-Oct4 (Addgene Plasmid #13366), pMXs-Sox2 (Addgene Plasmid #13367) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors containing Cre-inducible GCaMP6f (AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40, Addgene; TIter≥2.1×13 GC/ml) were injected into the right DLS or DMS by stereotaxic surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... we delivered GCaMP6f under control of the synapsin promoter (AAV1/9-SYN-GCaMP6f; Addgene, #100837)51 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/9 (University of Pennsylvania Gene Therapy Program Vector Core) or pAAV2/retro (#81070; Addgene), trans plasmid ...
-
bioRxiv - Bioengineering 2024Quote: For transgene expression studies with AAV vectors we used the following AAV expression plasmid:pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA was a gift from Hirokazu Hirai (Addgene plasmid # 190163 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Immunology 2024Quote: ... and pGEX-4T2-14-3-3 tau (θ) (Addgene #13281) were gifts from Michael Yaffe (Yaffe et al ...
-
bioRxiv - Neuroscience 2021Quote: ... under a flex promoter was obtained from the University of Pennsylvania Vector Core (AAV2/9.Syn.Flex.GCaMP6f.WPRE.SV40, CS0641, Penn Vector Core via Addgene). Lateral septum viral injections were targeted at the following coordinates ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Microbiology 2020Quote: ... CRISPR/Cas-9 vectors were derived from the plasmid lentiCRISPRv2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ; http://n2t.net/addgene:12260; RRID:Addgene_12260), and 3 µg of pCAGGS-S (SARS-CoV-2)(Catalog No ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-9 20 nL injections of AAV1-Syn-flex-GCaMP6s (Addgene #100845-AAV1, Chen et al., 2013) were delivered to the RSC (AP ...
-
bioRxiv - Biochemistry 2020Quote: ... and for luciferase assays a ratio of 1:9:10 HA-Clover plasmid:pcDNA(-):HRE-Luciferase (Addgene #26731) was used (physiological expression levels) ...
-
bioRxiv - Neuroscience 2022Quote: ... versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459; titer: 9 × 1012 gc/ml). To ablate PVNOT neurons ...
-
bioRxiv - Neuroscience 2024Quote: The plasmid WPRE-ab (pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA) was obtained from previous studies in our laboratory (Addgene plasmid #190163). The plasmid CAG-eYFP-3x-miR708-5p-TS was a gift from Viviana Gradinaru (Addgene plasmid #117381 ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083; http://n2t.net/addgene:36083; RRID:Addgene_36083), 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2020Quote: ... H357 and SCC-9 cells were transfected with RRBP1 overexpression plasmids pcDNA4 HisMax-V5-GFP-RRBP1(Addgene:Cat#92150) using the ViaFect transfection reagent (Promega Cat# E4982) ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-Ef1a-DIO hChR2 (E123T/T159C)-EYFP (gift from Karl Deisseroth, packaged into AAV serotype 9 from Addgene, plasmid # 35509 ...
-
bioRxiv - Microbiology 2022Quote: ... PCDNA3-GFP1-9 T2A mCherry was a gift from Xiaokun Shu (Addgene plasmid # 124430;http://n2t.net/addgene:124430; RRID:Addgene_124430) (PMID ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells (between passage 9-11) were transfected with lentiviral packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...