Labshake search
Citations for Addgene :
901 - 950 of 1931 citations for tert Butyl 2 chloro 5H pyrrolo 3 4 b pyridine 6 7H carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus expressing either Bmal1- or Per2-promoter driven luciferase reporter was produced by transfecting HEK293T cells with 6 µg psPAX2 (Addgene #12260), 3.6 µg pMD2G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2024Quote: hCMEC/D3 brain endothelial cells were grown to confluency in 6-well culture plates and transfected with 1µg of a β-Catenin luciferase reporter plasmid (M50 Super 8x TOPFlash - Addgene #12456) and 35ng of Renila reporter plasmid (pRL-TK Promega #E2231 ...
-
bioRxiv - Bioengineering 2024Quote: ... was used in conjunction with one of three different RepCap plasmids (7m8,5 Addgene, #64839; pAAV-DJ,6 Cell Biolabs, VPK-420-DJ; pAAV2/1, Addgene, #112862), and a self-complementary AAV cargo vector (see design below ...
-
bioRxiv - Genomics 2024Quote: ... HEK293 cells were seeded at 1.2×106 cells per well of 6-well plate and transfected with pMD2.G (Addgene plasmid # 12259), pCMVR8.74 (Addgene plasmid # 22036 ...
-
bioRxiv - Cancer Biology 2024Quote: ... a NALM-6 clone bearing an integrated doxycycline-inducible Cas9 expression cassette generated by lentiviruses made from pCW-Cas9 (Addgene #50661) was transduced with the genome-wide KO EKO sgRNA library83 (278,754 different sgRNAs) ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Neuroscience 2022Quote: ... The loops were shuttled into pCSF107mT-GATEWAY-3’-3HA (gift from Todd Stukenberg, Addgene plasmid # 67616) using Gateway LR clonase ...
-
bioRxiv - Immunology 2020Quote: ... Guide sequences (listed in Supplementary Table 3) were cloned into the lentiCRISPR v2 plasmid (Addgene #52961) and lentiviral particles were generated in 293T cells (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 HRE luciferase cells were generated by co-transfection of 3xHRE-luciferase construct (Addgene 26371) with a puromycin-resistant construct ...
-
bioRxiv - Neuroscience 2022Quote: [3] ie1: An enhancer/promoter from pGL3-IE1 (a gift from Zach Adelman, Addgene ID #52894) (Anderson et al. ...
-
Improving the efficacy and accessibility of intracranial viral vector delivery in non-human primatesbioRxiv - Neuroscience 2022Quote: ... Subjects MTL1-3 were infused with two retrograde viruses (gifted from Edward Boyden & Karel Svoboda; Addgene viral preps #59170-AAVrg & #29017-AAVrg ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.CamKII(1.3).eYFP.WPRE.hGH was a gift from Karl Deisseroth (Addgene plasmid# 105622; http://n2t.net/addgene:105622; RRID:Addgene_105622).
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... and (3) GFP1-10 from pFA6a-link-yGFP1-10-CaURA3MX (Addgene 86419; (Smoyer et al., 2016)) and subsequent cloning into the XhoI/NotI sites of pRS304 mito-DsRed.
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene, #78534). The puromycin resistance cassette in pLentiCRISPRv2 was replaced by a GFP gene using standard cloning techniques ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-GAL4DBD ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-VP16 ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Molecular Biology 2023Quote: ... with 3 million K562 cells and 10 µg of pCMV-PE2-tagRFP-BleoR (Addgene no. 192508) per individual electroporation (Day 0) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected using (per condition) 3 µg of pLKO.GFP transfer plasmid (Addgene, #30323) containing the shRNA (sequences in Supplementary Table S6) ...
-
bioRxiv - Neuroscience 2024Quote: USP14_Reverse: 5’ AAACCCAATGGTATTCAAGGCTCACC 3’ were cloned into pSpCas9(BB)-2A-Puro vector (PX459, 62988, Addgene, USA) using FastDigest BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles containing the sgRNA against mouse Rap1 (target: 5’-GCAGTCTAGGATGTACTGCG-3’) in lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2024Quote: Full-length human CEP152 with gRNA resistance (5’-CAGAACAGTTAGAAATGAGT-3’) in pAID 1.1C-T2A-Bsr (Addgene) and CEP152D43/44A in pEGFP-C1 were synthesized by GenScript ...
-
bioRxiv - Cell Biology 2024Quote: ... reverse primer: 5’-ATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC-3’) and cloned into pLentiCRISPRv2-Opti (a gift from David Sabatini; Addgene plasmid # 163126 ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077; http://n2t.net/addgene:27077;RRID:Addgene_27077) [pCXLE-hUL ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Cell Biology 2020Quote: HA-NFAT1(4-460)-GFP was a gift from Anjana Rao (Addgene plasmid # 11107). Patterned cells expressing NFAT-GFP was imaged using Zeiss LSM 880 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-phSyn1(S)-FLEX-TdTomato-T2A-Syp-EGFP (Addgene #51509, 4 x 1014GC/mL) was injected (60nL at 20nL/min ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Neuroscience 2021Quote: Mice anaesthetized using isoflurane were bilaterally infused with pAAV2-hSyn-DIO-hM3D(Gq)- mCherry (≥ 6 × 1012 vg/mL; Addgene #44361, Lot v58216). After exposing the skull and creating small <2mm bilateral holes with a dental drill (Stoelting ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Neuroscience 2023Quote: ... For DREADD experiments 6-7 week old mice were injected bilaterally with the inhibitory virus AAV-hSyn-hM4D(Gi)-mCherry (AddGene, 50475-AAV2) or control virus AAV-hSyn-EYFP (AddGene ...
-
bioRxiv - Biophysics 2023Quote: ... was expressed in E.coli using a gene with an N-terminal 6×His-tag and an upstream TEV-protease site cloned into pET28a(+) (Addgene plasmid #20061). MSP1D1 was purified using IMAC with further cleavage of 6×His-tag by TEV protease 50,51 ...
-
bioRxiv - Neuroscience 2023Quote: ... were designed to target CEP290 exon 6 and cloned into the pSpCas9(BB)-2A-GFP (PX458; gift from Feng Zhang; Addgene plasmid #48138). RPE1 cells were transfected with this plasmid by using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: To measure mitophagy in HUVEC were seeded in 6-well plates (8 x 105 cells/well) and transfected with 5ug/well of pCHAC-mt-mkeima plasmids (Addgene plasmids #72342) at a ratio of 1:1.5 plasmids ...
-
bioRxiv - Developmental Biology 2023Quote: HEK293T cells were plated at a density of 2.8×105 cells in 6-well plates and transfected with MSCV-flag-PRDM16 (Addgene, 15504; RRID:MSCV PRDM16) and/or pCDNA3-NKX2-174 using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ppyCAG_RNaseH1_WT employed for the transient overexpression of RNAseH1 in vitro on HEPA1-6 cells was a gift from Xiang-Dong Fu (Addgene plasmid #111906).
-
bioRxiv - Immunology 2024Quote: ... 293T cells were transfected with 10 ug of lenti-CRISPR-V2-CRE construct along with packaging plasmid 6 ug of PsPAX2 (Addgene, Cat #12260) and 3.5 ug of PmD2.G (Addgene ...
-
bioRxiv - Biochemistry 2024Quote: ... was subcloned into the pET His 6 glutathione-S-transferase (GST) TEV LIC cloning vector (2G-T, obtained from Scotta Gradia, Addgene plasmid #29707) and transformed into BL21 (DE3 ...
-
bioRxiv - Bioengineering 2024Quote: ... 8 × 106 reporter cells were transduced in 6-well format with 1 ml Human Brunello CRISPR knockout pooled library (Addgene #73178 31) in the presence of 10 μg/ml polybrene (Merck Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: A plasmid encoding human TDP-43 with a C-terminal His×6-MBP tag was purchased from Addgene (pJ4MTDP-43, Addgene #104480). Two additional plasmids encoding IDRsTDP-2(Extended Data Fig ...