Labshake search
Citations for Addgene :
901 - 950 of 1397 citations for Recombinant Human TNFRSF17 protein Fc His tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: For validation experiments we introduced the fluorescent protein EBFP2 (source: Addgene 54665) driven by the dpse enhancer and the CG13116 promoter in the RD-seq plasmid backbone to be able to gate for transfected cells in flow cytometry (Suppl ...
-
bioRxiv - Cell Biology 2022Quote: ... For LRP6 and ADAMTSL2 protein interaction studies the LRP6-pCS2 (Addgene, 27242) was used for co-transfection ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids expressing the SARS-CoV-2 S protein were obtained from Addgene: pcDNA3.3-SARS2-B.1.617.2 (Delta ...
-
bioRxiv - Immunology 2023Quote: ... 700 ng/mL of Protein A/G-MNase (plasmid Addgene ID:123461) were added to the immunocomplexes ...
-
bioRxiv - Neuroscience 2024Quote: Enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1) was commercially purchased (Addgene). The fluorescent protein mKate was inserted into a pcDNA3.1(- ...
-
bioRxiv - Molecular Biology 2019Quote: ... dCas9-expressing cells were then transduced with the Calabrese Human CRISPR Activation Pooled Library (Set A, Addgene, 92379-LV) using enough cells to obtain a library coverage of 500 cells per sgRNA at an MOI of 0.4.17 Selection with puromycin (0.6 μg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and cloned into a bicistronic expression vector (pX330) containing human codon-optimized Cas9 and RNA components (Addgene, #42230). The guide sequences targeting the AMPKα1 gene (PRKAA1 ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
bioRxiv - Genomics 2020Quote: ... Cas9 expressing human melanoma cell line 2686 was transduced with lentiviral particles produced as described above using expression plasmid pXPR_011 (Addgene #59702 ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR Brunello genome-wide knockout library was a gift from David Root and John Doench (Addgene #73178). MelJuSo cells stably expressing FLAG-VGLL3 were generated and two batches of 100 million cells were infected at an MOI of 0.3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... we used the sequence of a human codon optimized Streptococcus pyogenes Cas9 (SpCas9) obtained from pX330-U6-Chimeric_BB-CBh-SpCas9 from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG5 knockout P3 and T98G GBM cell lines were generated by using LentiCRISPRv268 (purchased from Addgene, plasmid# 99573). Plasmids were transfected into 293T cells using BBS/CaCl2 to produce lentivirus ...
-
bioRxiv - Cancer Biology 2021Quote: ... full-length human SETDB1 cDNA was cloned into the NotI sites of the pcDNA3.1(+)-IRES-GFP (Addgene; Cat#: 51406). For transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human cells used for RNA sequencing were first integrated with Not1-linearized pBABE-neo-hTERT plasmid (Addgene plasmid # 1774) and selected with G418 ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of human myogenin (gift from Matthew Alexander & Louis Kunkel (Addgene plasmid #78341; http://n2t.net/addgene:78341; RRID: Addgene_78341) and mScarlet (Bindels et al. ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... human umbilical vein endothelial cells (HUVECs) were infected with lentivirus constructs for CRISPR/Cas9 (Addgene plasmid #52961, lentiCRISPR v2) induced knock-out for Rbpj35 ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The mouse Spdef cDNA and human SPDEF cDNA were synthetized from IDT and cloned into LentiV P2A Blast (Addgene_111887) using Gibson assembly (NEB).
-
bioRxiv - Microbiology 2021Quote: ... The wildtype human HIF1α gene was obtained from pcDNA3-HIF1α plasmid (Addgene 18949, a gift from William Kaelin (45)) ...
-
bioRxiv - Microbiology 2020Quote: The production of high titer Human sgRNA Brunello lentiviral library which contains 4 sgRNA per gene (15) (Addgene #73178), was performed by transfecting HEK293T cells in five 15 cm tissue culture plates using PEI (Polyethylenimin Linear ...
-
bioRxiv - Immunology 2019Quote: ... The sgRNA oligos were annealed and ligated into the human codon-optimized SpCas9 expression plasmid (pX330; Addgene plasmid # 42230), as described previously63 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a non-human control were amplified from the pSB700 plasmid and cloned into PB-TRE-dCas9_VPR (Addgene #63800) using the following primers ...
-
bioRxiv - Cell Biology 2019Quote: Human GeCKOv2 CRISPR knockout pooled library (Pooled Library #1000000048)35 and pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid # 42230)97 were gifts from Feng Zhang ...
-
bioRxiv - Immunology 2020Quote: Individual sgRNAs from human v2 library78 were cloned into lentiviral vectors expressing either a Puromycin resistance cassette (60955, Addgene) or into a modified vector expressing a Blasticidin resistance cassette (Gift from Nevan Krogan ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding amino acids Ala696-Phe740 of human DDX1 was cloned into UC Berkeley MacroLab 438C (Addgene plasmid #55220). The resulting plasmid encoded for untagged RTCB(1-505) ...
-
bioRxiv - Microbiology 2020Quote: ... the human ACE2 gene (Miaolingbio #P5271) was PCR-amplified and cloned into the pLV-EF1a-IRES-blast (Addgene #85133). The human TMPRSS2 and DPP4 gene (Sino Biological #HG13070-CM ...
-
bioRxiv - Biochemistry 2022Quote: The expression plasmid for full-length human TRIM21 (HLTV-hTRIM21, referred to as TRIM21FL) was ordered from Addgene (#104973). Recombinant TRIM21FL was expressed and purified as described previously (Clift et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The human ACE2 coding sequence was amplified and inserted into the vector plasmid pLV-EF1α-IRES-Puro (#85132, Addgene) for transient expression in HEK293T cells to obtain virus containing the target gene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The human Brunello CRISPR knockout pooled sgRNA library was a gift from David Root and John Doench (Addgene #73178). sgRNA library lentivirus was produced via large-scale transfection of 20 × 150mm dishes of HEK293T/17 (12 × 106 cells/dish were plated and transfected with 30 µg plasmid DNA the following day) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected either rAAV2/10 encoding ChrimsonR(K176R) and the red fluorophore tdTomato under control of the human synapsin promoter (1.13 × 1013 gc/ml; AddGene plasmid #59171 ...
-
bioRxiv - Neuroscience 2022Quote: ... and the cyan fluorophore mCerulean under control of the human synapsin promoter (1.5 × 1012 gc/ml; customized from AddGene plasmid #59171 ...
-
bioRxiv - Cell Biology 2023Quote: Human genome targeting CRISPR Knock-Out (GeCKO) v2 lentiviral pooled libraries (A and B libraries) were purchased from Addgene and amplified according to a published protocol (Sanjana et al. ...
-
bioRxiv - Microbiology 2023Quote: ... A no-template preparation (negative control) and a plasmid encoding egfp (positive control, pClneoEGFP human RASSF6b, Addgene plasmid #37021), along with non-transduced EBECs and HBECs were included ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentiviral constructs for HMGA2 overexpression were obtained by sub cloning human HMGA2 from pMXS-hs-HMGA2 (Addgene, no. 52727) into pCDH-EF1a-eFFly-mCherry replacing eFFly using restriction enzymes XbaI and BamHI-HF ...
-
bioRxiv - Biochemistry 2023Quote: Human Brunello genome-wide CRISPR KO pooled library (gift from David Root and John Doench, Addgene catalog no. 73178) was amplified by electroporation into Stbl4 electrocompetent cells (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... The reporter plasmids were subcloned using the vector backbone of pGL410_INS421 which has a human insulin promotor regulating firefly luciferase expression (a gift from Kevin Ferreri Addgene plasmid #49057 ...
-
bioRxiv - Cell Biology 2023Quote: pEGFP-N1 human cofilin WT / S3A / S3E were a kind gift from James Bamburg (Addgene plasmid # 50859 / # 50860 / # 50861). Cofilin-1 ...
-
bioRxiv - Genetics 2023Quote: The rTetR(SE-G72P)-HDAC4-T2A-mTurquoise plasmid was generated by PCR amplifying full length human HDAC4 with appended gibson homology arms from pLB37_PB_pGK-H2B-mIFP-T2A-rTetR-HDAC4-zeo (Addgene #179440) using Q5 hot start polymerase (NEB M0494S) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726; http://n2t.net/addgene:59726; RRID: Addgene_59726) and targeted the first exon of the TBXT gene ...
-
bioRxiv - Genetics 2023Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722 ...
-
bioRxiv - Immunology 2024Quote: The human Calabrese CRISPR activation pooled library was a gift from David Root and John Doench (Addgene 92379, 92380). To subclone this pool we digested our protospacer-empty Libr.1-null transfer vector with BsmBI-v2 (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse vsv-plexin-B3 and human pECE-M2-BAIAP2 (IRSP53-Flag) were purchased from Addgene (#68038, #68039, #31656, USA).
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Developmental Biology 2024Quote: ... The TFAP2A gRNA targeted site of human TFAP2A construct (gift of Robert Tjian, Addgene #12100, (Williams and Tjian, 1991)) was mutated using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: cDNAs encoding human TSSK6 were obtained in pDONR223 (DNASU) and cloned into pLX302 or pLX304 (Addgene Plasmid #25896, #25890) using the Gateway Cloning system (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2019Quote: ... Green fluorescent protein (GFP) from the Gateway entry vector pENTR4-GFP-C1 (Addgene) was transferred to pYES-DEST52 and pAG426GAL-ccdb using Gateway LR Clonase ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat (DR ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat (DR ...
-
bioRxiv - Molecular Biology 2019Quote: ... The nanodisc scaffold protein MSP1D1 was expressed and purified using pMSP1D1 (Addgene #20061) as described previously (Denisov et al. ...