Labshake search
Citations for Addgene :
901 - 950 of 1451 citations for Recombinant Human PRMT5 Flag & His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... pcDNA3-HA-human OCRL (gift from Pietro De Camilli, Addgene plasmid # 22207); pCDNA3.0_mitoLAMA-G97 (gift from Kai Johnsson ...
-
bioRxiv - Cancer Biology 2020Quote: The Brunello CRISPR library targeting the human genome was obtained from Addgene (via John Doench and David Root ...
-
bioRxiv - Cancer Biology 2020Quote: ... human PML SUMO-1 mutant and GFP-BLM were purchased from Addgene (#62804 ...
-
bioRxiv - Systems Biology 2021Quote: The human Toronto knockout v3 (TKOv3) genome-scale CRISPR library (Addgene #90294) was used to perform pooled CRISPR knockout screens in Vero E6 ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 13.8μg of Human CRISPR Knockout Pooled Library (GeCKO v2) (Addgene # 1000000049) part A or part B were combined with Lipofectamine 3000 (Thermo Fisher Scientific # L3000015 ...
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Neuroscience 2021Quote: ... The human CD68 promoter32 was cloned into the lentiviral vector FG12 (Addgene) using XbaI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: Plasmid encoding human ACE2 (hACE2) was obtained from Addgene (hACE2; catalog #1786). The hACE2 2.6 kbp ORF was also blunt-cloned into a third generation HIV vector 3’ of CMV promoter and 5’ of an IRES- puror cassette to generate pHIV-CMV-hACE2-IRES-Puro ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human EGFRvIII expression was induced using pMSCV-XZ066-EGFRvIII (Addgene, plasmid 20737) and murine hEGFRvIII+ B-ALL cells were generated ...
-
bioRxiv - Biophysics 2022Quote: ... The His6-SUMO tag was subsequently cleaved with human SenP1 (Addgene #16356) 27 and separated on Ni2+-Histrap HP column ...
-
bioRxiv - Biochemistry 2022Quote: ... The full-length human PIK3R5 (p101) gene was purchased from Addgene (70464), and the full-length human PIK3R6 (p84 ...
-
bioRxiv - Neuroscience 2022Quote: ... pEGFP-LC3 (human) was a gift from Toren Finkel (Addgene, Plasmid #24920). pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... Human TXNRD1 sequence was cloned from a cDNA provided by Addgene (#38863), and TXNRD2 was synthesized as a gBlock gene fragment by IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... tagBFP-Rab35 (Human Rab35; in lentivirus vector pLVX-M-puro (Addgene 125839)) ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074 ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Biochemistry 2023Quote: ... Human codon optimized wild-type Mpro was obtained from Addgene (catalog #141370). Mpro single point mutants (M49A ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049 ...
-
bioRxiv - Neuroscience 2021Quote: For Ca2+ indicator expression at M1, recombinant AAV vectors (rAAVs, serotype 1) encoding jRGECO1a under the control of the synapsin promoter (Addgene #100854-AAV1) was stereotaxically delivered as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... A template vector which carries full-length AID-3 × FLAG-P2A-BSD was produced with the backbone of pMK392 (Addgene, 121193). Full-length AID-3×FLAG-P2A-BSD was integrated into the site just before the terminal codon of the sub-cloned CENP-E gene ...
-
bioRxiv - Genomics 2019Quote: ... 2012) Flag tag and MCS was cloned into the pMT-puro expression plasmid (a gift from David Sabatini, Addgene plasmid # 17923). Drosophila cDNA or the cDNA for the eGFP protein was then cloned into the resultant expression plasmid ...
-
bioRxiv - Molecular Biology 2019Quote: ... Retroviral vectors for JMJD6 expression were generated by cloning the Jmjd6 coding sequence with a C-terminal FLAG-tag sequence (11) into the pBABE plasmid vector containing the neomycin resistance gene (Addgene #1767). Mutant versions of JMJD6 were generated from the wild type construct using QuikChange Lightning site-directed mutagenesis kit (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: VSV-G–pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene
-
bioRxiv - Cell Biology 2021Quote: ... Mito-mCh-1×FLAG and Mito-mCh-smFLAG were constructed by ligating 1×FLAG synthesized by overlapping PCR and smFLAG amplified from smFLAG-KDM5B-24×MS2 (Addgene # 81084) with previously built Mito-mCh-1×HA cut by BglII and BamHI through Gibson Assembly.
-
bioRxiv - Microbiology 2020Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2021Quote: Previously described pMIG-Aalpha WT retroviral vector with a Flag-tag at the NH2 terminal (32) obtained from Addgene (plasmid #10884) was generously provided by William Hahn ...
-
bioRxiv - Molecular Biology 2022Quote: FLAG-NKX2-1 or FLAG-GFP open reading frame (ORF) was cloned into pLEX_306 (a gift from David Root, Addgene plasmid #41391). Cells stably expressing Cas9 were generated by infection with the lentiCas9-Blast plasmid (Addgene # 52962 ...
-
bioRxiv - Developmental Biology 2022Quote: ... a pcDNA Flag HA vector with the Sufu open reading frame cloned from pcDNA Su(fu) (CT #116) (Addgene plasmid: 13857)[24] using BamHI (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: The tagging strategy was based on a two-step tagging technique 45 using a tagging cassette based on the plasmid FLAG-LoxP-PURO-LoxP-HaloTERT WT HR Donor (Addgene # 86843), with the Halo-Tag exchanged by EGFP ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... low passage HEK293T cells were co-transfected with the corresponding pInducer20-FLAG-SMS2 construct and the packaging vectors psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2020Quote: We using the 3*Flag sequence to replace the GFP protein in the pLenti CMV GFP Puro vector (Addgene, 658-5) for adding some Restriction Enzyme cutting site (XbaI-EcoRV-BstBI-BamHI ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragments are then cloned into a mammalian expression vector containing Flag and mEGFP (N- or C-terminal) (modified from Addgene #32104) using NEBuilder HiFi DNA Assembly kit (E2611) ...
-
bioRxiv - Cell Biology 2023Quote: ... PH-FFAT/N-PH-FFAT sequences (5’-NheI/3’-AscI) were amplified by PCR from pLJM1-FLAG-GFP-OSBP plasmid (Addgene#134659). The sequences encoding Twitch (Twitch2b/Twitch7x/Twitch8x/Twitch9x ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with AAVS1-TRE3G-Mic10-FLAG-T2A-EGFP (Stephan et al., 2020, EMBOJ), AAVS1-TRE3G-DmMIC10-FLAG-T2A-EGFP, or AAVS1-TRE3G-EGFP (Qian et al., 2014) (Addgene 52343), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... LysoGFP-Sac1 and LysoGFP-Sac1 C389S were made by subcloning LysoGFP-Sac1 from pLJM1-Lyso-FLAG-GFP-Sac1-Cat-WT (Gift from Roberto Zoncu (Addgene #134645)) and pLJM1-Lyso-FLAG-GFP-Sac1-Cat-CS (Gift from Roberto Zoncu (Addgene #134653) ...
-
bioRxiv - Neuroscience 2023Quote: ... A single vector CRISPR/Cas9 system was developed by replacing CMV-SP-PW-IRES-GFP with the hU6-Filler-EFS-SpCas9-FLAG-P2A-Puro cassette from lentiCRISPRv2 (Addgene #52961). To monitor the transduction rate ...
-
bioRxiv - Cell Biology 2023Quote: U2OS T-REx FLAG-HA-FAM134s stable and inducible cell lines were infected with lentivirus carrying the pCW57-CMV-ssRFP-GFP-KDEL (Addgene #128257). We previously deleted the tetracycline response element ...