Labshake search
Citations for Addgene :
901 - 950 of 1154 citations for Mouse Putative Phospholipase B Like 2 PLBD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... lentivirus was produced in HEK293FT cells transfected with NOCT Δ(2-15)-3F pCW57.1 and the pRSV-Rev (Addgene #12253), pMD2.G (Addgene #12259) ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pHCKan-yibDp-CBD-hGLY was constructed by DNA assembly with 2 PCR products amplified from (i) a plasmid coding hGLY under a T7 promoter (pHCKan-T7-CBD-hGLY, Addgene #134940 ...
-
bioRxiv - Genetics 2020Quote: ... the reporter construct was made by cloning the sequence for Renilla luciferase and SARS-CoV-2 frameshift signal in the 0 frame upstream of the firefly luciferase sequence in the pISO plasmid (Addgene), with firefly luciferase in the −1 frame ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was a gift from Jason McLellan (7) and obtained from Addgene (plasmid #154754 ...
-
bioRxiv - Cell Biology 2020Quote: ... was made by replacing the mCitrine in pA2721 with eGFP and correcting the frame shift mutation (missing a G at codon#2) in the natMx6 coding sequence in the original plasmid acquired from Addgene. The TurboID tagging plasmid (pA2859 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Genomics 2021Quote: An sgRNA targeting PSAP exon 2 (sgRNA sequence: GGACTGAAAGAATGCACCA) was cloned into plasmid px330-mcherry (px330-mcherry was a gift from Jinsong Li (Addgene plasmid # 98750 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Genomics 2022Quote: The PCR product was cloned into the pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 vector (Addgene #6125554) using HindIII and XbaI restriction sites ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Neuroscience 2022Quote: ... that target exon 2 of TREM2 nearby the location of R47H (G>A) and a genomic TTAA were purchased from Addgene. A donor plasmid was made comprising homology arm 1 (HA1 ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... a 50:50 mix of AAV8-CamKII-mCherry (Neurophotonics, Laval University, Quebec City, Canada, Lot #820, titre 2×1013 GC/ml) and AAVrg-CAG-GFP (Addgene, Watertown ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Physiology 2023Quote: ... sgRNA primers were (Table 2) cloned into BbsI-HF linearized pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene, Plasmid Cat. #64324) or pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Biophysics 2023Quote: ... cells transfected with pcDNA3.1-mGL-picALuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Biophysics 2023Quote: ... RRID:Addgene_141370)72 or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: A 2.2 kb BamHI-SalI cDNA fragment of the long form of human PREPL (PREPLL) was cloned into pLenti-GFP (Addgene) digested with the same restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... the resistance cassette flanked by LoxP sites (Sec16) was excised by transfection of 2 µg of pBS598 EF1alpha-EGFPcre plasmid (plasmid #11923; Addgene) that encodes for cre recombinase.
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Supplementary Table 2) into the BbsI restriction sites of the pX459 vector (#62988, Addgene). An empty pX459 vector was used to generate matching control cell lines ...
-
bioRxiv - Biophysics 2023Quote: ... and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids encoding spikes of SARS-CoV-2 variants Delta (Cat. No. 172320) and Omicron (Cat. No. 179907) were procured from Addgene, USA.
-
bioRxiv - Biochemistry 2023Quote: ... cells were transiently co- transfected for 24 h with plasmids for expression of full-length, N-terminal tagged (Flag, HA or tandem Strep tag) BRSK1/2 (or Cys-Ala mutants) and GFP-TAU (Addgene), using 3:1 polyethylenimine (average Mw ...
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... expressing Cas9 nuclease and two gRNAs (see below for sequences) together with the CRIS-PITCh vector pX330S-2-PITCh (63670, Addgene), harboring the Lamin A microhomologies and GFP-Puro or GFP-Neo/Kan insertions ...
-
bioRxiv - Cell Biology 2019Quote: ... David Virshup and Xi He (Addgene, Watertown, MA, USA, kit #1000000022) (8) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Volume I was a gift from Richard Murray (Addgene kit #1000000161). pSEVA331Bb was a gift from Tom Ellis (Addgene plasmid # 78269 ...
-
bioRxiv - Cell Biology 2023Quote: ... and the Target Accelerator Pan-Cancer Mutant Collection (Addgene Kit #1000000103)29.
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...