Labshake search
Citations for Addgene :
901 - 950 of 1134 citations for Estrone 3 Sulfate E1S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... we infected H9c2s with shRNA against RORα or scrambled shRNA for 48hrs then transfected with an EGFP-Cav-3 plasmid (Addgene plasmid #68396) or empty EGFP plasmid and an mRaspberry-Mito-7 plasmid (Addgene #55931 ...
-
bioRxiv - Cell Biology 2020Quote: ... targeting KIF4A sequence 5’-GCAAGATCCTGAAAGAGAT-3’ was generated using a multipurpose GATEWAY-based lentiviral tetracycline-regulated conditional RNAi system (GLTR) using pENTR-THT-III (Addgene plasmid #55791) and pGLTR-X-Puro (Addgene plasmid #58246 ...
-
bioRxiv - Neuroscience 2021Quote: ... Adjacent 2kb 5’ and 3’ homology regions were cloned into pHD-DsRed-attP (gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger, Addgene plasmid # 51019, RRID:Addgene_51019) 5’ region via EcoRI/NotI ...
-
bioRxiv - Genomics 2020Quote: ... the 3×Flag-BUD13-6HIS fragment was transferred into the pLJM1 lentiviral construct using the NdeI and EcoRI sites (Addgene plasmid # 19319). We produced lentiviruses via co-transfection of pCMV-d8.91 ...
-
bioRxiv - Genomics 2022Quote: ... the genome-wide CRISPR-Cas9/KO Toronto Knockout version 3 library from Hart and team (Hart et al., 2017) (Addgene no. 90294), cloned into the 1 vector system (lentiCRISPRv2 carrying Cas9 and sgRNA expression on the same vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA) ...
-
bioRxiv - Neuroscience 2023Quote: ... 150nl of AAV2-hSyn-DIO-hM3D(Gq)-mcherry or 150-600nl of AAV2-hSyn-DIO-mCherry (3×1012 vg/ml, 5.1×1012 vg/ml and 5.6×1012 vg/ml, respectively; Addgene and UNC Vector Core) into the MeA of Foxp2cre+/- mice ...
-
bioRxiv - Neuroscience 2022Quote: miR-30a-chimeric hairpins for miR-329 and miR-495 stable overexpression were generated via polynucleotide cloning into the 3’ UTR of eGFP in pAAV-hSyn-EGFP vector (Addgene Plasmid #114213) using BsrGI and HindIII sites ...
-
bioRxiv - Developmental Biology 2022Quote: ... HEK293T cells at 70-80% confluency in 10 cm dishes were transfected with the insert construct plus 3rd generation packaging plasmids: pMD2.G (3 μg, Addgene plasmid #12259), psPAX2 (6 μg ...
-
bioRxiv - Cancer Biology 2023Quote: ... and non-targeting sgRNA controls (SCR; supplementary table 3) flanked with BsmBI overhangs were ligated into the vector FgH1tUTG-GFP (Addgene Plasmid #70183) using 1uL BsmBI (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we designed a construct for the first tier of the dCas9-based cascade that is expressed from the EF1α promoter and contains a SapI-flanked cloning site in the 3’UTR for adding a gRNA to target a downstream target: “EF1a-Triplex-28-M13-28-pA” (Addgene ID 202041). Detailed protocols for modifying all of these constructs are provided on the Addgene website.
-
bioRxiv - Cancer Biology 2023Quote: ... 5’ and 3’ fragments containing incorporated mutated gene ORF sequences were amplified by PCR from the pDONR223-TP53 WT plasmid (Addgene; Plasmid #82754). In this case ...
-
bioRxiv - Developmental Biology 2023Quote: ... were transfected with 3 μg targeting vector pUC19-OCT4-T2A-NLS-EmGFP-P2A-Puro (kind gift from Timo Otonkoski; Addgene plasmid #89992) and 3 μg of PX459 plasmid (kind gift from Feng Zhang ...
-
bioRxiv - Cell Biology 2024Quote: ... was either mutagenized in a 3 kb cloning plasmid (pKSPS (Bahri et al., 2021)) before subcloning into pQCXIB (the retroviral expression vector, Addgene plasmid #22800) or was directly mutagenized in pQCXIB ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Cancer Biology 2019Quote: The CRISPR kit used for constructing multiplex CRISPR/Cas9 vectors was a gift from Takashi Yamamoto (Addgene kit #1000000054). Guide RNAs targeting LRP5 and LRP6 were designed using the Zhang Lab Optimized CRISPR Design Tool (http://crispr.mit.edu) ...
-
bioRxiv - Plant Biology 2022Quote: ... a modular cloning system was employed using MoClo Tool Kit and MoClo Plant Parts kit (Addgene, Supplemental Table S3) (Weber et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9; http://n2t.net/addgene:100833; RRID:Addgene_100833). pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... For the Tg(fliEP:loxRFPlox:DNtal) construct the 5’ entry clone 478 p5Efli1ep was a gift from Nathan Lawson (Addgene plasmid # 31160 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (serotype AAV1, viral titer ≥ 5×1012 vg/mL; Addgene, Watertown, MA, USA), pAAV-hSyn-hM4D(Gi)-mCherry (serotype AAV retrograde ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ; http://n2t.net/addgene:104964 ; RRID:Addgene_104964) and 64.6 μg of either the CalEx plasmid (pZac2.1-GfaABC1D-HA-hPMCA2w/b ...
-
bioRxiv - Cell Biology 2019Quote: ... replacing the mCherry coding sequence in pFA6a-mCherry:Hph with the coding sequence for the photo-switchable fluorescent protein mEOS3.2 (5) (Addgene) by standard restriction-digestion cloning (using restriction enzymes BamHI and AscI ...
-
bioRxiv - Cell Biology 2021Quote: mApple-Alpha-5-Integrin-12 was a gift from Michael Davidson (Addgene plasmid # 54864; http://n2t.net/addgene:54864; RRID:Addgene_54864) mCherry-Clathrin LC-15 was a gift from Michael Davidson (Addgene plasmid # 55019 ...
-
bioRxiv - Developmental Biology 2022Quote: ... plasmid DNA (5 ng/μl) and Tol2 transposase mRNA(4 ng/μl) (synthesized from pT3TS-Tol2 Addgene #31831) were injected into one-cell stage embryos ...
-
bioRxiv - Genomics 2022Quote: ... 5 μg DNA was incubated with1.75 μg pMD2.G and 3.25 μg pCMV-dR8.91 (Addgene, Watertown, MA; #12259). On the next day ...
-
bioRxiv - Plant Biology 2023Quote: ... in a one-step restriction-ligation reactions with a double CaMV35s-ΩTMV promoter/5′ UTR (pICH51288; Addgene #50269), a C-terminal GR tag (pEPOZ0CM0137 ...
-
bioRxiv - Genetics 2023Quote: ... and the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897, kind gift from Dr. Peter Varnai) (Tóth et al. ...
-
bioRxiv - Cell Biology 2023Quote: We synthesized gRNAs flanking exon 4 and 5 and cloned them into the gRNA cloning vector (Addgene # 41824) using Gibson assembly (New England Biolabs)[19] ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... Transfection control contained 5% pEGFP puro (a gift from Michael McVoy, Addgene plasmid #45561(Abbate et al. 2001)) ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454) using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... c-Myc-5-HT2A was a gift from Javier Gonzalez-Maeso (Addgene plasmid # 67944 ; http://n2t.net/addgene:67944 ; RRID:Addgene_67944). 3xHA-5HT2a plasmid was purchased from cDNA Resource Center ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ LTR of BLV was synthesized and cloned in (pTripCMVGFP) by Genescript.The commercial plasmids Lenti DR8.75 (Addgene #22036) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids: 0.5×106 target cells were cultured in 6-well plates and transfected with pEGFP-SKL (Addgene#53450 from Jay Brenman Lab) plasmids using TurboFect Transfection Reagent (Thermo-Scientifics R0531 ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were plated at 70-80% confluence in 6 well plates and transfected with 1μg of each plasmid containing 7a and 7b sgRNAs (Addgene #113620 and #113624) using Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: To measure mitophagy in HUVEC were seeded in 6-well plates (8 x 105 cells/well) and transfected with 5ug/well of pCHAC-mt-mkeima plasmids (Addgene plasmids #72342) at a ratio of 1:1.5 plasmids ...
-
bioRxiv - Developmental Biology 2023Quote: HEK293T cells were plated at a density of 2.8×105 cells in 6-well plates and transfected with MSCV-flag-PRDM16 (Addgene, 15504; RRID:MSCV PRDM16) and/or pCDNA3-NKX2-174 using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... We introduced a single guide RNA (gRNA) targeting the 3’ region of the TgApiAT1 locus into the vector pSAG1::Cas9-U6::sgUPRT (Addgene plasmid # 54467; [34]) using Q5 site-directed mutagenesis (New England Biolabs ...
-
bioRxiv - Genetics 2021Quote: ... Cas9 and dCas-VP64 Calu-3 knock-in lines were then transduced with Brunello and Calabrese Set A libraries (Addgene #73179 and #92379) as appropriate ...
-
bioRxiv - Molecular Biology 2022Quote: ... Conditional knockout cells were generated by infection with media from a confluent 10 cm dish of 293T cells transfected with 3 µg pCL-Eco (Addgene, 12371 ref (17)) and 3 µg MSCV CreERT2 puro (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: The HIV-derived construct pNL4-3(eGFP)(NL4-3 RRE)(TagBFP) (pHR5580) was packaged and VSV-G pseudotyped using a transient second generation packaging system including psPAX2 (Addgene plasmid 12260, pHR5691) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Microbiology 2020Quote: ... containing 40bp of the 5’ end of cobK to a second 923-bp PCR-generated fragment (FR2) containing 107bp of the 3’ end of cobK in a three-way ligation reaction with p2NIL backbone (Addgene plasmid #20188; (46)) ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... DREADD+ group) was bilaterally injected in the dDG with pAAV5-CaMKIIa-hM4D(Gi)-mCherry (virus titer ≥ 3×1012 vg/ml, Addgene, North Carolina, USA). Inhibitory DREADDs are activated by the artificial ligand clozapine-N-oxide (CNO ...
-
bioRxiv - Neuroscience 2024Quote: ... and 80-100nl of either AAV5-hSyn-hChR2(H134R)-EYFP (UNC Vector core) or pAAV9-mDlx-ChR2-mCherry-Fishell-3 (Addgene viral prep # 83898) was injected into the right GPi or SNr ...
-
bioRxiv - Plant Biology 2021Quote: ... the kit (Golden Gate TALEN and TAL Effector Kit 2.0) consisting of 86 library vectors was ordered from Addgene (www.addgene.org). To assemble the dTALe harboring 16 repeats ...
-
bioRxiv - Plant Biology 2020Quote: ... The following binary plasmids were assembled by Golden Gate cloning using the MoClo Tool Kit for plants (Addgene kit #1000000044) (Weber et al. ...