Labshake search
Citations for Addgene :
901 - 950 of 977 citations for Cow Casein Kinase II Subunit Alpha 2 CSNK2A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... with AgeI and BstBI restriction sites into the pLenti CMV/TO GFP-MDC1 (779-2) (plasmid #26285, Addgene, gift from E. Campeau; Genewiz) backbone ...
-
bioRxiv - Genomics 2019Quote: ... We co-transfected the pLentiRNACRISPR constructs together with a GFP expression plasmid in a 2:1 molar ratio. The guide RNA length comparison (Supplementary Fig. 1d) was done using previously published RfxCas13d constructs (Addgene 109049 and 109053), except that we removed the GFP cassette from the RfxCas13d plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Cancer Biology 2020Quote: pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines were obtained upon transfection of the SAOS 2 cell line with the plasmids pBABE-puro or pBABE-puro-hTERT from Addgene (#1764, #1771, respectively), and Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines presented in this study are available from the corresponding author upon request and all plasmids are available from Addgene (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned from pLVX- EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro and pLVX-EF1alpha-SARS-CoV-2-E-2xStrep- IRES-Puro (kind gifts from Nevan Krogan, available from Addgene #141386 and #141385) using PCR to remove the 2xStrep epitope tag ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660), the lentiviral expression plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...
-
bioRxiv - Systems Biology 2021Quote: ... individual drivers were PCR amplified out of the Cancer Pathways kit (Addgene #1000000072)21 ...
-
bioRxiv - Biochemistry 2021Quote: ... The RAS clone collection was a gift from Dominic Esposito (Addgene kit 1000000070). GST tagged RAF1-RBD (GST-RAF-RBD ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we performed two-step cloning using a Platinum Gate TALEN kit (Addgene, #1000000043). In the assembly-step 1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The ENO1 terminator fragment was amplified from pYTK051 (Addgene Kit #1000000061 position E3) (Lee et al ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Microbiology 2021Quote: ... the open reading frame was amplified by PCR from the pDONR223 SARS-CoV-2 NSP5 plasmid (Addgene, #141259, a gift from Fritz Roth [32]), including an ATG start codon in the forward primer and a TAA stop codon in the reverse primer (MPro_Fw ...
-
bioRxiv - Immunology 2020Quote: ... pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-SARS-CoV-2-S-RBD-sfGFP plasmids were gifts from Erik Procko (Addgene plasmids #145163 and #141184). pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Neuroscience 2023Quote: ... Michael Ward and the 2 CLYBL targeting TALEN plasmids (pZT-C13-R1 and pZT-C13-L1, gifts from Jizhong Zou Addgene.org: #52638 and 52637, respectively) by the same method with the Neon Transfection System (40) ...
-
bioRxiv - Neuroscience 2023Quote: Foreskin fibroblasts were transfected with the AAVS1-DOX-KRAB-dCAS9 plasmid and the 2 AAVS1 Talen plasmids (Gifts from Danwei Huangfu, Addgene plasmid # 59025 and 59026) using the Neon Transfection system (38) ...
-
bioRxiv - Cancer Biology 2020Quote: ... KIT D816V ESCs were generated as described previously using the pX335 vector (Addgene 42335) and oligonucleotides listed in supplemental Table 3.29
-
bioRxiv - Cancer Biology 2022Quote: ... Luciferase/tdTomatao reporter was engineered using the MuLE system kit from Addgene (Cat. # 1000000060) (54).
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2019Quote: ... CDC45: guide#1 GCATCAGGGTCGGGCTCTGA and guide#2 GCTCTGTCCTCCCTCAACGG) were inserted into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene plasmid #42335, a gift from Feng Zhang) via BbsI restriction site ...
-
bioRxiv - Neuroscience 2023Quote: 750 nl of rAAV.EF1a.DIO.hChR2(H134R).eYFP or rAAV.EF1a.DIO.eYFP (3-4 x 10^12 vg/ml, AAV5, University of North Carolina Vector Core; 1-2 x 10^13 vg/ml, AAV1, Addgene, 27056-AAV1 and 20298-AAV1) were injected into each hemisphere of the VTA of 3–4-month-old DAT-Cre mice ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The BGA polyadenylation signal was amplified from plasmid C7 (MXS Chaining Kit; Addgene reference #62424)[15] and the Ef1A promoter was amplified from plasmid C4 (MXS Chaining Kit ...
-
bioRxiv - Synthetic Biology 2019Quote: ... synthetic gene fragments from Integrated DNA Technologies (IDT) and the EcoFlex kit (47) from Addgene.
-
bioRxiv - Synthetic Biology 2021Quote: All remaining plasmids were generated using Goldengate cloning with the MoClo toolkit (Addgene Kit#1000000044) as described in Weber et al ...
-
bioRxiv - Neuroscience 2021Quote: Human DRD1 and DRD2 in pcDNA vectors were achieved using the PRESTO-Tango kit (Addgene). To generate R-DRD1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Gβ and Gγ-GFP2 constructs were purchased as part of the TRUPATH kit from Addgene.
-
bioRxiv - Molecular Biology 2023Quote: ... cerevisiae Advanced Gateway™ Destination Vectors were a gift from Susan Lindquist (Addgene kit #1000000011).
-
bioRxiv - Neuroscience 2023Quote: ... TALE repeat arrays were assembled using the Joung Lab REAL Assembly TALEN kit (Addgene 1000000017). Synthesized TALEN mRNAs were injected into the cytoplasm of one-cell stage embryos ...
-
bioRxiv - Systems Biology 2024Quote: ... Gβ3 and Gγ9-GFP2 were purchased as part of the TRUPATH biosensor kit from Addgene. The oligonucleotides for making the GαsE392K-Rluc8 and GαsL388R-Rluc8 mutations were designed using Agilent Technologies’ online primer design tool ...
-
bioRxiv - Cell Biology 2019Quote: To generate clonal cell lines that are deficient for SURF4, a sgRNA targeting SURF4 exon 2 (SI Appendix, Table S1) was cloned into the PX459 plasmid (Addgene: 62988, a gift from Feng Zhang) as previously described (95) ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Microbiology 2021Quote: ... The coding sequence from amino acid 747E to 1061K was amplified by PCR from the pDONR207 SARS-CoV-2 NSP3 plasmid (Addgene, #141257, a gift from Fritz Roth[32]), including a Kozak sequence and ATG start codon in the forward primer and a TAA stop codon in the reverse primer (PLPcd_Fw ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and terminator parts used in the constructs described were provided by Douglas Densmore (Addgene kit 1000000059).
-
bioRxiv - Biophysics 2020Quote: We assembled TALE-TF with the Golden Gate TALEN and TAL Effector Kit2.0 (Addgene kit #1000000024) 101 as previously described 23 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Addgene reference #62424)[15] and the Ef1A promoter was amplified from plasmid C4 (MXS Chaining Kit; Addgene reference #62421).
-
bioRxiv - Biochemistry 2022Quote: ... The Saccharomyces cerevisiae Advanced Gateway Destination Vector Kit was purchased from Addgene (Watertown, MA, United States). Phusion high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Bioengineering 2022Quote: ... This plasmid was then used as a template for Golden Gate-based cloning (MoClo Plant Kit, Addgene) (47) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into the pPD95.77 vector (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Neuroscience 2020Quote: We employed a two-step Golden Gate assembly method using the Platinum Gate TALEN Kit (Addgene; cat#1000000043) to construct Platinum TALEN plasmids containing the homodimer-type FokI nuclease domain ...
-
bioRxiv - Molecular Biology 2021Quote: ... the inserts from the entry clones were subcloned into pAG413GAL-ccdB and pAG416GAL-ccdB vectors (Addgene kit #1000000011) [31] by LR Gateway reaction (Invitrogen™) ...
-
Reconstitution of prospermatogonial specification in vitro from human induced pluripotent stem cellsbioRxiv - Developmental Biology 2020Quote: ... TALEN constructs targeting DDX4 were generated using a Golden Gate TALEN and TAL Effector kit 2.0 (Addgene, #1000000024)69 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The annealed oligo products were directionally cloned into the Addgene Multiplex CRISPR/Cas9 Assembly Kit (Addgene, Watertown, MA) as crRNA genes for sgRNA expression ...