Labshake search
Citations for Addgene :
901 - 950 of 1046 citations for Cow Casein Kinase II Subunit Alpha 2 CSNK2A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...
-
bioRxiv - Neuroscience 2023Quote: Viral injections were performed postnatally at P1-2 with in-house produced according to or commercially available viral vectors AAV-php.eB-hSyn-gCamp7f (Addgene Plasmid #104488) or AAV-php.eB-S5E2-ChR2-mCherry (Addgene Plasmid #135634 ...
-
bioRxiv - Microbiology 2023Quote: ... and pRN-Luc (50 ng) reporter plasmids in combination with S protein expressing plasmids pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... We expressed the soma-targeted opsin ST-ChrimsonR 43 in excitatory neurons by injecting a virus (1012 titer; AAV2/2 camKII-KV2.1-ChrimsonR-FusionRed; Addgene, plasmid #102771) into the craniotomy ...
-
bioRxiv - Neuroscience 2023Quote: ... was mixed in a 1:10 ratio with AAV5-syn-GCaMP6s and injected into PM and AAV5-Syn-SIO-eOPN3-mScarlet (2−1013 gc/mL; Addgene #125713) was injected into either LP ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Genetics 2024Quote: Two sgRNAs targeting the start and end of the rme-2 coding sequence were in vitro transcribed from a SP6 transcription template amplified from pDD162 (Addgene #47549) using primers P42 (start sgRNA ...
-
bioRxiv - Bioengineering 2024Quote: An all-in-one Cas9/gRNA expression construct encoding an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene; 129727) was placed downstream of the hU6 promoter in a PX458 (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a lentiCRISPR vector (Addgene (52961) 45 ...
-
bioRxiv - Biophysics 2024Quote: ... the HECT domain consisting of residues 615-994 of full-length NEDD4-2 (a gift from Joan Massague, Addgene plasmid # 27000) (66 ...
-
bioRxiv - Cancer Biology 2024Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Molecular Biology 2024Quote: ... and SARS-CoV-2 nsP3 Mac1 (Kind gift by Sarah Knapp, RWTH Aachen) were subcloned into a Sleeping Beauty vector (Addgene #60506). The Sleeping Beauty vector was co-transfected with a Sleeping Beauty Transposase (Addgene #34879 ...
-
bioRxiv - Biochemistry 2024Quote: Mutations of phosphorylation sites within the SR region were generated via site-directed mutagenesis based on either the tag-free SARS-CoV-2 Nucleocapsid protein plasmid (Addgene, #177937) or the Strep-tagged SARS-CoV-2 Nucleocapsid protein plasmid (Dr ...
-
bioRxiv - Microbiology 2024Quote: ... BHK-21/WI-2 cells were infected with vTF7-3 for 45 min and then transfected with pVSV-EGFP-dG (Addgene 31842) or pVSV-FLuc-dG and pBS vectors encoding the N ...
-
bioRxiv - Neuroscience 2024Quote: ... EnvA-N2C-dG-tdTomato (2×109, Center for Neuroanatomy with Neurotropic Viruses, CNNV)m AAV9-hSyn-DIO-hM4d(Gi)-mCherry (Addgene #44362)32 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The EMMA toolkit was a gift from Yizhi Cai (Addgene kit # 1000000119) [25] ...
-
bioRxiv - Neuroscience 2019Quote: ... using the Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene 1000000024). TALEN mRNAs were synthesized by in vitro transcription using the mMessage mMachine SP6 Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... The EMMA toolkit was a gift from Yizhi Cai (Addgene kit # 1000000119). Various parts from the toolkit were used for construction of the vectors ...
-
bioRxiv - Molecular Biology 2023Quote: ... David Virshup and Xi He from the plasmid kit73 (Addgene kit # 1000000022). HALO*EBP-HA and HALO*EBP constructs were originated from a pBSM13-Pax7HALO plasmid that was designed in our lab ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast Toolkit plasmids were a gift from John Dueber (Addgene kit # 1000000061). pAJ4619 was made from pAJ4618 by inverse PCR using oligos AJO3551 and AJO3539 ...
-
bioRxiv - Plant Biology 2024Quote: ... The MoClo Toolkit was a gift from Sylvestre Marillonnet (Addgene kit # 1000000044) (Weber et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... sgRNA against exon 23 (Table 2) was cloned downstream of the U6 promoter of the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene plasmid # 48138) 61 ...
-
bioRxiv - Biophysics 2022Quote: HEK 293T cells were co-transfected with either pmNG-Mpro-Nter-auto-NLuc or pmNG-Mpro-Nter-auto-L-NLuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (Addgene plasmid # 141370) or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dUP-Cd63 and dUP-Myt1l (2 mg/ml, subcloned from double UP mClover to Scarlet, Addgene #125134, Taylor et al., BioRxiv 2019); DFRS ...
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp14 was subcloned into a modified pBIG1a vector containing a pLIB-derived polyhedrin expression cassette to either contain an N-terminal 3xFlag-6His tag (sequence: MDYKDHDGDYKDHDIDYKDDDDKGSHHHHHHSAVLQ-nsp14) or no tag to generate SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164). Baculoviruses were generated and amplified in Sf9 insect cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Plant Biology 2021Quote: ... pICH47811-pTCSn::nls:tGFP (position 2) was cloned together with pICH47802-pIPT3::nls:tdTOMATO::t35S (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014).
-
bioRxiv - Cell Biology 2021Quote: ... LifeAct mScarlet cell lines were generated by electroporating 2 μg/ml of pLifeAct-mScarlet-N1 plasmid DNA (a gift from Dorus Gadella, Addgene plasmid 85054) into WT and CD56-KO NK92 cells using the Amaxa nucleofector (Kit R ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6J mice received unilateral injections of AAVrg-CaMKIIα-mCherry (200 nl at 200 nl/min, titer 2×1013 vg/ml, #114469-AAVrg, Addgene, MA, USA) into the right main OB (0.5 mm lateral from midline ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cell Biology 2022Quote: ... INS-1 832/3 EV or g1-2 SNAP-GLP-1R cells were transfected with the pCI HA NEDD4 construct (a gift from Prof. Joan Massague, Addgene plasmid #27002) 24 hours before the experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The S1R-Apex and GFP-Apex plasmids were co-transfected into either HeLa cells (ATCC; CCL-2) or HEK293T cells (ATCC; CRL-3216) along with pXAT2 (Addgene plasmid 80494) (30) ...
-
bioRxiv - Immunology 2020Quote: ... the lentiCas9-v2 lentivirus were produced from HEK-293FT cells transfected with the lentiCas9-v2 plasmid mixed at a 2:1:1 DNA ratio of the lentiviral packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Systems Biology 2020Quote: ... Cells were transformed by standard lithium acetate methods to fluorescently labelled indicated organelles with monomeric Kusibara Orange 2 (mKO2) obtained from Addgene (Cambridge, MA). Peroxisomes in strains engineered with deletions of DNM1 ...
-
bioRxiv - Biochemistry 2021Quote: ... Templates used to create the PCR fragments were pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (gift from Nevan Krogan; Addgene plasmid #141382), pCEP4-myc-ACE2 (gift from Erik Procko ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles were produced in HEK293 cells after transient transfection of the packaging vectors psPAX.2 and pMD.G2 (Addgene #12260 and #12259). After viral transduction ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Microbiology 2023Quote: The ISRE-Luc reporter plasmid (32) (25 ng) was either transfected alone or co-transfected with a plasmid expressing SARS-CoV-2 genes NSP13 (Addgene, cat. 141379) (25 ng) ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...