Labshake search
Citations for Addgene :
901 - 950 of 1661 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: Synthetic complementary oligos targeting POLDIP2 (5’-CACCGCGCGTCGTCGTGGTCGACGC-3’ and 5’-AAACGCGTCGACCACGACGACGCGC -3’) were cloned into PX459-SpCas9 (Addgene, (35)) at the BbsI site ...
-
bioRxiv - Genetics 2024Quote: ... We transduced hiPSCs from two control donors (553-3, male; 3182-3, female) with lentiviral pUBIQ-rtTA (Addgene #20342) and tetO-NGN2-eGFP-NeoR (Addgene #99378 ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2023Quote: 750 nl of rAAV.EF1a.DIO.hChR2(H134R).eYFP or rAAV.EF1a.DIO.eYFP (3-4 x 10^12 vg/ml, AAV5, University of North Carolina Vector Core; 1-2 x 10^13 vg/ml, AAV1, Addgene, 27056-AAV1 and 20298-AAV1) were injected into each hemisphere of the VTA of 3–4-month-old DAT-Cre mice ...
-
bioRxiv - Neuroscience 2024Quote: ... The efficiency of viral-genetic receptor KO was established in an separate experimental cohort of Esr1loxP or PRloxP animals which received unilateral MPOA injections of either AAV2/5-CMV-EGFP-Cre (250 nl, Addgene 105545, 2 × 1013 GC / ml) or AAV2/5-CMV-EGFP (250 nl ...
-
bioRxiv - Neuroscience 2020Quote: [4] QF2w-Hsp70frompQF2wWB(Addgene plasmid #61313) (Primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (4 µg, Addgene plasmid # 12260) and pAdVAntage (1.6 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μg of psPAX2 (Addgene #12260) and 8 μg of purified pLKO.1 plasmid containing the shRNA constructs upon reaching 70% confluency ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μg of psPAX2 (Addgene, 12260), and 6 μg of GIPZ Non-silencing Lentiviral shRNA (control ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of psPAX2 (Addgene #12260), and 1 μg of pCMV-VSV-G (Addgene #8454 ...
-
bioRxiv - Biophysics 2024Quote: ... was genetically fused to the C-terminus of CD86 (Addgene plasmid #98284),[66] CTLA-4 (Addgene plasmid #98285)[66] and EGFR (Addgene plasmid #32751)[67] by replacing the fluorescent protein (mEos2 or EGFP ...
-
bioRxiv - Developmental Biology 2021Quote: ... The following guides 5’-GGACCTGTTCGGAATCCACC-3’ and 5’-GGGTGAGGTTCTGTCTACCC-3 were separately cloned into the BbsI site of pU6-BbsI-chiRNA plasmid (obtained from Addgene) and both were simultaneously injected by Best Gene into w1118 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Microbiology 2023Quote: ... Truncation mutations in NL4-3 were created by subcloning the region of NL4-3 between EcoRI to XhoI into pBlueScript KS(-) (Addgene), followed by site-directed mutagenesis to introduce a stop codon to generate the desired truncation mutation ...
-
bioRxiv - Cancer Biology 2024Quote: UMUC-3 TM4SF1-KO cells were generated by transient transfection (Lipofectamine 3000) of UMUC-3 cells with PX458 (Addgene, #48138). Each plasmid contained one of three different sgRNA targeting sequences ...
-
bioRxiv - Immunology 2024Quote: ... the oligo targeti ng NAIP (5’-CCGGGCCGTGGTGAACTTTGTGAATCTCGAGATTCACAAAGTTCACC ACGGCTTTTTG-3’ and 5’-AATTCAAAAAGCCGTGGTGAACTTTGTGAATCTCGAGA TTCACAAAGTTCACCACGGC-3’) was cloned into pLKO.1 puro (8453, Addgene), w hich was then used for lentiviral construct as above ...
-
bioRxiv - Cell Biology 2024Quote: ... chimeric TOM40-APOE3 and TOM40-APOE4 fused at their 3’-ends to 3×Flag were synthesized from Genewiz and inserted into pCW57.1 (Addgene #41393) with EcoRI (ThermoFisher Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-Flpo-3×FLAG (no. 173047, Addgene), which has the hSyn promoter followed by Flpo with 3×FLAG C-terminal tag (OGS629 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5ng of a reference plasmid (pNL4-3, Addgene) was spiked in to each DNA preparation and used for qPCR normalization (Table S1) ...
-
bioRxiv - Immunology 2021Quote: ... 3 μg of pIRES-eGFP plasmid DNA (Addgene) were digested with 250 U of Benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3 µg VSVG packaging vector (Addgene, 8454) in a 100 mm dish using a calcium phosphate transfection kit (CalPhos Mammalian Transfection kit ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 μg pCMV-VSV.G (Addgene, Watertown, MA; #8454), and 4 μg CD19-CAR-GFP transfer plasmid (Bloemberg et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-Flpo (Addgene #125576, 3-10 ng/μL) and pCAFNF-tdTomato (Addgene#125575 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 with primers 1010.C5 and 1010.C6 ...
-
bioRxiv - Bioengineering 2020Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 19 with primers 986.C3 and 986.C4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 3 μg of pCXWB-EBNA1 (Addgene #37624) were co-nucleofected into 1×106 primed hiPSCs using the Lonza 4D-nucleofector (“Primary Cell P3” solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... pN3-3×Flag-Control was purchased from Addgene (Watertown ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3) AAV9-hSyn-ChR2(H134R)-eYFP (RRID:Addgene_127090 ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247). Ligation reactions were carried out by mixing 1 µL 10x NEB CutSmart buffer ...
-
bioRxiv - Cell Biology 2024Quote: mCherry-ER-3 (mCherry-KDEL; Addgene plasmid #55041) and mEmerald-TGNP-N-10 (Addgene plasmid #54279 ...
-
bioRxiv - Cell Biology 2024Quote: ... pGEX-4T-3-mR7BD (Addgene #79149, Edinger Lab), mCherry (Clontech) ...
-
bioRxiv - Immunology 2024Quote: ... and pCS2-HA-14-3-3η (Addgene #116887) were a gift from Feng-Qian Li & Ken-Ichi Takemaru (Li et al ...
-
bioRxiv - Bioengineering 2024Quote: ... Separately 3 μg of pMD2.G (Addgene #12259), 12 μg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Cell Biology 2024Quote: ... and pCFJ104 (Pmyo-3::mCherry, Addgene #19328 [86]). The site of mAID::mNG insertion was verified by PCR on the genomic DNA of homozygous progeny ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13 I224A/L227A/W276A/I279A (ΔLIR1+3) (RRID:Addgene_223754), BCL2L13 W276A/I279A/I307A/V310A (ΔLIR1+4 ...
-
bioRxiv - Biochemistry 2024Quote: ... (1/2)NORAD-4xenv8-FL-3’antiPNA (Addgene plasmid #199208), or (1/8)NORAD-4xenv8- FL-3’antiPNA (Addgene plasmid #199209) ...
-
bioRxiv - Microbiology 2024Quote: ... pcDNA-V5-NSP3 was generated by amplifying the full-length NSP3 ORF from pDONR207 SARS-CoV-2 NSP3 (Addgene #141257; a gift from Fritz Roth (86)) and by subcloning it into the pcDNA3-C-V5 vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...