Labshake search
Citations for Addgene :
901 - 950 of 1982 citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915). The integration orientation of yellow progenies from MiMIC injection and 3xP3-GFP-progenies from CRIMIC injection were confirmed by PCR genotyping ...
-
bioRxiv - Systems Biology 2023Quote: ... Each promoter was then cloned into the pMW#2 (Addgene #13349) and pMW#3 (Addgene #13350 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259) and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pDONR207 SARS-CoV-2 nsp1 R124A/K125A (M2, Addgene #164523) plasmids using the primers 5-EX-NSP1 and 3-NB-NSP1 and cloned into pEGFP-N1 digested with EcoRI and NotI enzymes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1000 ng frame selector (pCAS9-mCherry-Frame +0/+1/+2, Addgene plasmid #66939/#66940/#66941 ...
-
bioRxiv - Cell Biology 2024Quote: ... and marker pCFJ90 (Pmyo-2-mCherry; Addgene #19327, 2.5 ng/µL) was injected into N2 young adult hermaphrodites ...
-
bioRxiv - Neuroscience 2024Quote: ... Each sgRNA was cloned into pU6-2-sgRNA-short (Addgene 41700) plasmid and two plasmids were co-injected into vas-Cas9 line (BDSC # 51324 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-M-2×Strep-IRES-Puro(Addgene#141386, Wuhan-Hu-1) with NotI/BamHI- ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-E-2×Strep-IRES-Puro (Addgene#141385, Wuhan-Hu-1), pLVX-M-2×Strep-IRES-Puro(Addgene#141386 ...
-
bioRxiv - Biochemistry 2024Quote: The Cilantro 2 reporter vector (PGK.BsmBICloneSite-10aaFlexibleLinker-eGFP.IRES.mCherry. cppt.EF1α.PuroR, Addgene #74450) was used for flow-based degradation assays ...
-
bioRxiv - Cancer Biology 2024Quote: U□2 OS cells transfected with pDR-GFP plasmid (Addgene, 26475) using GenJet (SignaGen Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: The Cilantro 2 reporter vector (PGK.BsmBICloneSite-10aaFlexibleLinker-eGFP.IRES.mCherry. cppt.EF1α.PuroR, Addgene 74450) was used for flow-based degradation assays ...
-
bioRxiv - Bioengineering 2024Quote: ... and [2] pRSV-Rev was a gift from Didier Trono (Addgene plasmid 12253 ...
-
bioRxiv - Microbiology 2024Quote: ... and pCI-neo-CHIKV or pMD2.G (2 μg, Addgene #12259) using polyethylenimine (PEI ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 μg of pMD2.G (Addgene plasmid #12259, from Trono lab) and 6 μg of psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Cancer Biology 2021Quote: Galectin-3 cDNA was subcloned into the pMIG-GFP retroviral expression vector (plasmid #9044, AddGene, Cambridge, MA). Stably transduced hGalectin-3 expressing OP9 cells were generated by infecting cells with retroviral particles and FACS sorting of GFP expressing (positively transduced ...
-
bioRxiv - Molecular Biology 2021Quote: ... pYM-N2339 and pFA6a-hphMX-(3×FLAG)-TEV-ProtA (gift from Michael Nick Boddy, Addgene plasmid # 52692).
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082; http://n2t.net/addgene:54082; RRID:Addgene_54082). Cells were seeded on high precision coverslips (Marienfeld ...
-
bioRxiv - Cell Biology 2021Quote: ... GST Tat was generated by cloning pNL4-3 derived tat gene in pGEX-4T1 vector from Addgene. HA Tat and Flag NQO1 were purchased from Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328; http://n2t.net/addgene:19328; RRID:Addgene_19328); 100 ng/µl of a construct expressing Cas9 and a sgRNA targeting the sequence ACATGAGTCTGTGTTTACGG (derived from pDD162 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 106 HEK293T cells were transfected using GenJet transfection reagent (Signagen) with 7.5 µg psPax2 (Addgene #12260), 5 µg VSV-G (pMD2.G ...
-
bioRxiv - Neuroscience 2020Quote: A Nectin-3 overexpression construct was created by modifying a pCag-iCre expression vector (Addgene plasmid # 89573). Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase ...
-
bioRxiv - Physiology 2022Quote: ... or scramble short hairpin RNA (shRNA) (Table 3) was inserted into the plasmid pLKO.1 (8453; Addgene). pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were reverse-transfected with 3 plasmids: psPAX2 (a gift from Didier Trono, Addgene #12260), pEGFP-Vpr (obtained through the NIH HIV Reagent Program ...
-
bioRxiv - Neuroscience 2023Quote: Cortical neurons control and VPS50 mKO were co-infected at 3 DIV with GCaMP7f (Addgene Cat#104488). At 10 DIV ...
-
bioRxiv - Genomics 2023Quote: ... vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719; http://n2t.net/addgene:44719; RRID:Addgene_44719) (Ding et al ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411; http://n2t.net/addgene:49411; RRID:Addgene_49411). His3.3A reference sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus expressing gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, stock concentration 3 x 1013 vg/mL, Addgene, 104488-AAV1)53 ...
-
bioRxiv - Microbiology 2024Quote: The full-length HIV vectors NL4-3 ΔEnv EGFP (HIV Reagent Program) and HIVGKO (Addgene plasmid #112234) were produced in HEK293T cells along with the VSV-G (Addgene plasmid # 8454 ...
-
bioRxiv - Molecular Biology 2022Quote: pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
bioRxiv - Microbiology 2022Quote: ... RSAD2 forward 5’ caccgAGTGGTAATTGACGCTGGTG 3’ and reverse 5’ aaacCACCAGCGTCAATTACCACTc 3’) were designed using CHOPCHOP web tool (https://chopchop.cbu.uib.no/) and cloned into pLentiCRISPR v2 vector (Addgene) as described [92 ...
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and then merged it into the 3’UTR of eGFP expression cascade in LPutopia-7 (Addgene #199212) plasmid ...
-
bioRxiv - Immunology 2024Quote: ... pEMB52-14-3-3_1_247 (γ) was a gift from the Michael J Fox Foundation MJFF (Addgene #40541); pcDNA-HA-14-3-3β (Addgene #13270) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For co-transfection of NT-3 cells with siRNAs and RINS1 plasmid (gift from Dmytro Yushchenko, Addgene plasmid # 107290 ...
-
bioRxiv - Immunology 2024Quote: ... and packaging plamids 7.5 μg of psPAX2 and 3 μg pMD2.G (Addgene plasmids #12260 and #12259). 12 hours after transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Sup. Table 3) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410)76 ...
-
bioRxiv - Neuroscience 2024Quote: ... DV: -0.4) and 0.3μl of AAV.PHP.eB-CAG-DIO-tdTomato (28306-PHPeB, Addgene, 1×10¹3 vg/mL) was injected at a rate of 0.05μl/min ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with PL-SIN-EOS-C(3+)-EiP (a gift from James Ellis; Addgene #21313) and selected with 1 µg/mL of puromycin (Millipore ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and mCherry-ER-3 (a gift from Michael Davidson - Addgene plasmid # 55041; http://n2t.net/addgene:55041; RRID:Addgene_55041) constructs (Olenych et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 µg psPAX2 (psPAX2 was a gift from Didier Trono; Addgene plasmid # 12260) and 2 µg VSVg were mixed with 30 µL X-tremeGene9 transfection reagent (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The module 5 was taken from the pAJM.847 plasmid in (41) (Addgene #108524 ...
-
bioRxiv - Genomics 2020Quote: ... EF06R (5’UTR-LINE-1) was a gift from Eline Luning Prak (Addgene plasmid # 42940 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a WPRE (cloned from pLenti CMV GFP Puro (658-5) (Addgene #17448)) all flanked by epigenetic insulator sequences by repetitive restriction digests (KflI-EcoRI ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV1-hSyn-Cre-WPRE-hGH (Addgene, 10^13 gc/ml, diluted 1:5), AAV5-CAG-FLEX-tdtomato (UNC Viral Core ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μg pMDLg/RRE and 2.5 μg pRSV-REV (Addgene #14888, #12251, #12253) using calcium phosphate ...
-
bioRxiv - Cell Biology 2023Quote: ... 5*10^10 genomic copies of commercially produced AAV8-TBG-Cre (Addgene #107787) or control AAV8-TBG-GFP (Addgene #105535 ...
-
bioRxiv - Molecular Biology 2023Quote: ... to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792) and 5 µg of pCrePac(Taniguchi ...
-
bioRxiv - Neuroscience 2023Quote: The following viruses were used: AAV2/5-ef1alpha-FLEX-taCasp3-TEVp (Addgene, 45580) and AAV2/1-CAG-FLEX-EGFP-WPRE (Addgene ...