Labshake search
Citations for Addgene :
851 - 900 of 905 citations for Recombinant Human CLEC4M Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... expressing mRuby2 and GCaMP6s under the human synapsin promoter (pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA) was purchased from Addgene (50942-AAV1). NPCs were differentiated to neural cells as described above and transduced by adding 1.44 μl virus solution per well in a μ-Slide 4 Well 5 days after cell seeding ...
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336, #149334, #149333) (Pleiner et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... Raf1 gRNA sequence derived from a 3rd generation lentiviral gRNA plasmid targeting human Raf1 (A gift from John Doench, David Root, Addgene plasmid #76708). Specifically ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid pX330 for expression of human-codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA were obtained from Addgene (Cambridge, MA). The seed sequence for the SpCas9 target site in the target gene was tcggtgcagaccacctcccgcgg (underline ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Cell Biology 2019Quote: The cell line expressing a DELE1-mClover transgene line from the AAVS1 locus was generated by transfecting a cXG289 population in which ∼ 50% of cells expressed a DELE1-sgRNA and a BFP marker with pXG289 and TALENS targeting the human AAVS1 locus (AAVS1-TALEN_L/R, Addgene #59025 and #59026). Through FACS sorting ...
-
bioRxiv - Molecular Biology 2019Quote: ... The donor plasmid pAAVS1-TRE3G-NGN2 was constructed by replacing EGFP with human NGN2 in plasmid AAVS1-TRE3G-EGFP (Addgene plasmid # 52343). The donor plasmid pAAVS1-TRE3G-NGN2 (5 μg) ...
-
bioRxiv - Cell Biology 2020Quote: Human GeCKOv2 CRISPR knockout pooled library and lenti-Cas9-Blast was a gift from Feng Zhang (Addgene # 1000000049, (Sanjana et al., 2014)) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding human RTCB (Uniprot Q9Y3I0) was inserted using ligation-independent cloning into the UC Berkeley MacroLab 438B vector (Addgene plasmid #55219) and DDX1 (Uniprot Q92499) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral vectors containing wild type and DNA-binding mutants of PRRX1 were generated by cloning cDNAs encoding full length or homeodomain deletions of the human PRRX1A sequence into the pInducer20 lentiviral plasmid (gift from Stephen Elledge, Addgene plasmid #44012). The DNA-binding mutants harbor individual deletions of the three α-helices (ΔH1 ...
-
bioRxiv - Microbiology 2020Quote: ... Guide sequences for IPPK and IPMK were obtained from the Human GeCKOv2 CRISPR knockout pooled libraries (a gift from Feng Zhang; Addgene #1000000048, #1000000049) [32] ...
-
bioRxiv - Immunology 2021Quote: ... The S106C mutant of human ASC PYD (aa1-106) was cloned into an in-house modified pET28-MBP-TEV vector (Addgene, plasmid #69929), in which N-terminal His6 tag was added for expression of proteins with a cleavable N-terminal His6-MBP-tag ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: The lentiviral gRNA and pre-gRNA expressing backbones were constructed by cloning the human U6 promoter and CasRx gRNA or pre-gRNA scaffold (Addgene #109053, #109054) into lentiGuide-Puro (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pX330 plasmid for expression of the human codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA was obtained from Addgene (Cambridge, MA). The seed sequences for the SpCas9 target site in target genes are shown in Table S2 ...
-
bioRxiv - Cell Biology 2022Quote: ... were constructed by cloning the open reading frame (ORF) of human IRF1 or cMYC into a modified pLX303 vector (Addgene plasmid 25897). cDNAs encoding IRF1-SBDmut ...
-
bioRxiv - Genetics 2022Quote: ... in vitro transcription assays for human POU6F2 was performed using a reporter plasmid that encodes DsRed under a Hes5 promoter (Addgene, Cat# 26868). For POU6F2 expression vectors ...
-
bioRxiv - Neuroscience 2023Quote: ... A human Sirt3-RFP driven by the CaMKII promoter was constructed through PCR of the human Sirt3 sequence from Sirt3-FLAG (Addgene plasmid 13814)5 into the BamHI and AgeI sites of CaMKII-MICU3-RFP plasmid6 resulting in the linker sequence RPVVA joining Sirt3 and RFP sequences.
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Immunology 2023Quote: ... KO N/TERT keratinocytes were made and described in detail previously 27.MAP3K20 (ZAKα) KO human primary keratinocytes were generated using lentiviral Cas9 and guide RNA plasmid (LentiCRISPR-V2, Addgene plasmid #52961) using the following guides ...
-
bioRxiv - Genomics 2023Quote: ... The oligomer sequence was obtained from the data and the surrounding sequence was retrieved from the human STAP-seq screening vector sequence (Addgene ID: 125150). Both basepair level and TSS-level prediction and experimental measurements were compared ...
-
bioRxiv - Neuroscience 2023Quote: ... A 10-sgRNA-per-gene CRISPR/Cas9 deletion library (Human CRISPR Knockout library was a gift from Michael Bassik (Addgene # 101926-101934)) was infected into Cas9-expressing U937 cells as described16 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV encoding the cre-inducible excitatory designer receptor human M3 muscarinic receptor (hM3Dq; AAV2-Syn-DIO-hM3Dq-mCherry; Addgene, Watertown, MA) or fluorophore control (AAV2-Syn-DIO-mCherry ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2023Quote: ... MCF-7 or HeLa single cell colonies were selected from cells transduced with the following sequences targeting human genes cloned into lentiCRISPR v2 (Addgene no. 52961):
-
bioRxiv - Cell Biology 2023Quote: Donor plasmid encoding homology arms and linker-mEGFP sequence for C-terminus tagging of human NPM1 was designed by the Allen Institute for Cell Science and obtained from Addgene (AICSDP-50). The plasmid encoding NPM1-mEGFP was a gift from the Allen Institute for Cell Science (Addgene plasmid # 109122) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: The pooled Human GeCKO v2 CRISPR knockout plasmid library was a gift from Feng Zhang (41) and obtained from Addgene (#1000000048 and #1000000049). It is supplied as two sub-libraries ...
-
bioRxiv - Biochemistry 2021Quote: ... Pichia pastoris expression vector pPICZc carrying human β-actin fused with thymosin β4 and 6xHis-tag was a gift from Mohan Balasubramanian (Addgene #111146, RRID:Addgene_111146). β-Actin cDNA was mutated to introduce K50C and C374A for labeling with a cross-linking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: HT29 dCas9-VP64 clone E cells were transduced with lentivirus of Calabrese pooled human CRISPRa library set A and B (Addgene, 92379 and 92380) separately ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of human tau isoform 0N4R was subcloned into the pJFRC7 vector (Addgene, plasmid #26220. http://n2t.net/addgene:26220; RRID:Addgene_26220, a gift from Gerald Rubin43) to allow expression under the control of the GAL4/UAS system ...
-
bioRxiv - Cancer Biology 2024Quote: ... The construction of the two shRNA lentivirus vectors targeting the human β-catenin was performed following the Tet-pLKO Manual given by Addgene (plasmid#21915). The shRNA sequences used were the same as previously described (16) ...
-
bioRxiv - Microbiology 2022Quote: ... a total of 300 million A549-Cas9 cells were then transduced with the lentiviral human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang)(29 ...
-
bioRxiv - Microbiology 2020Quote: ... a total of 240 million Huh7.5.1-Cas9-blast or Huh7.5.1-Cas9-blast+ACE2-IRES-TMPRSS2-hygro cells were transduced with lentivirus of the human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at a moi of 0.4 and subsequently selected using puromycin and expanded for 7 days ...
-
bioRxiv - Physiology 2020Quote: The human codon-optimized Cas9 and chimeric guide RNA expression plasmid (pX459v2) developed by the Zhang lab were obtained from Addgene (Cong et al., 2013). To generate gRNA plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmid for tagging the N-terminus of the human lamin B1 gene (LMNB1) with RFP was purchased from Addgene (LMNB1-mTagRFP-T, #114403). The plasmid sequence was validated by Sanger sequencing.
-
bioRxiv - Microbiology 2022Quote: ... Dimeric human ACE2-IgG1 (hACE2) was generated by transfecting Expi293 cells with pcDNA3-sACE2-WT(732)-IgG129 (Addgene plasmid #154104, gift from Erik Procko) using 1 mg mL-1 PEI and then purifying from the supernatant five days post-transfection using rProtein A Sepharose (GE ...
-
bioRxiv - Neuroscience 2022Quote: ... the truncated human astrocyte-specific promoter hGfaABC1D (54) was digested from pAAV-GFAP-EGFP (donated by Dr. Bryan Roth, Addgene Plasmid #50473; RRID #Addgene_50473) and cloned into pAAV-EF1a-DIO-hM4D(Gi)-mCherry (donated by Dr ...
-
bioRxiv - Cell Biology 2021Quote: ... .The KIF1C motor domain was replaced with full length human KIF1C fused to mCherry from pKIF1C-mCherry (available from Addgene 130978 (Theisen et al., 2012)) using NheI and BsrGI ...
-
bioRxiv - Microbiology 2020Quote: ... a total of 300 million Huh7.5.1-Cas9 cells were then separately transduced with the lentiviral gRNA sublibraries A and B of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) at a multiplicity of infection (MOI ...
-
bioRxiv - Biochemistry 2021Quote: The RAS binding domain of C-RAF kinase (RAF-RBD) (Brtva et al., 1995) and full-length human RASSF5 from the RAS clone collection were obtained from Addgene (Raf1-RBD: #13338, RASSF5: #70545). The RAS clone collection was a gift from Dominic Esposito (Addgene kit 1000000070) ...
-
bioRxiv - Cell Biology 2022Quote: 6.0 × 10^6 BJAB clone B2 cells expressing both Cas9 and ERAAP dsRed were transduced with lentivirus of human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at an MOI of 0.4 using spin-infection (1,000 g for 2 h at 33 °C) ...
-
bioRxiv - Systems Biology 2022Quote: ... a total of 240 million A549-Cas9 cells were transduced with the lentivirus of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) (48 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...