Labshake search
Citations for Addgene :
851 - 900 of 2504 citations for Monobenzyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses were generated by co-transfection of viral vectors (2 μg) with pCMV-VSVG (0.25 μg) (Addgene) into Phoenix-gp cells with 90% confluency in a 6-well plate ...
-
bioRxiv - Microbiology 2022Quote: ... and are also available on Addgene (pLVX-EF1alpha-SARS-CoV-2-nsp14-2xStrep-IRES-Puro, Addgene #141380). Nsp10-Flag plasmid was a gift from the Ott lab.
-
bioRxiv - Biophysics 2022Quote: ... These cells (1.5 × 106) were transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (Addgene # 11923), a gift from Brian Sauer (Le et al. ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 S HexaPro plasmid was a generous gift from Jason McLellan (Addgene plasmid # 154754) (19) ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899 ...
-
bioRxiv - Neuroscience 2021Quote: ... mice received 50 nL of helper AAV2/8 syn.dio.TVA.2A.GFP.2A.B19G (UNC vector core) followed 2 weeks later by 300nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...
-
bioRxiv - Neuroscience 2022Quote: ... and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Supplemental Table 2) and cloned into pX459v2.0 (Addgene 62988) vector ...
-
bioRxiv - Immunology 2021Quote: Plasmid pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian (Addgene plasmid # 145780)68 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Microbiology 2022Quote: ... UL123 was also cloned into pLVX-EF1alpha-SARS-CoV-2-nsp1-2XStrep-IRES-Puro (Addgene plasmid #141367) in place of the SARS-CoV-2-nsp1-2XStrep cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli codon optimized SARS-CoV-2 genes from plasmid vectors synthesized by GinkoBioworks and distributed by Addgene. Amplified genes were digested with NdeI and SacI ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Immunology 2023Quote: ... the SARS-CoV-2 S 6P expression vector was a gift from Jason McLellan (Addgene plasmid #154754). The secreted protein was captured by Strep-Tactin affinity chromatography ...
-
bioRxiv - Biophysics 2023Quote: ... pCAGGS-SARS-CoV-2 S D614G (# 156421) and pcDNA3.1 vectors were obtained from Addgene (Watertown, MA, USA), and Invitrogen (Waltham ...
-
bioRxiv - Biochemistry 2023Quote: ... The pDONR223-PRKCB2 (PKCβII, uniprot identifier: P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746 ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for α-actinin-2-ABD was obtained from Addgene (RefSeq: NM_001103.3, Plasmid ID 52669) and PCR amplified using the forward primer AAACACCTGCAAAAAGGTATGAACCAGATAGAGCCCGGC and reverse primer AAATCTAGATTACTCCGCGCCCGCAAAAGCGTG ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNAs were amplified from the corresponding pJet1.2 vectors and pPD95.81 (a gift from Andrew Fire (Addgene plasmid # 1497; http://n2t.net/addgene:1497; RRID:Addgene_1497)) was a source of backbone and GFP sequences ...
-
bioRxiv - Neuroscience 2023Quote: Trh-Cre mice of age 2-3 months were injected with AAV1-hSyn-Flex-GCaMP6s (Addgene, 100845). More than 3 weeks after surgery ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pCOLA-Gent-EM7-Erv1p-PDI were both cloned with 2 fragment gibson assemblies (Addgene Cat#202486). For each assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... tbb-2 sequence was amplified using primers RA1792 and RA1793 and cloned into pPD95.75 (Addgene plasmid #1494) digested with EcoRI and SpeI using the NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... and pICH51288 and pICH41414 (2×35S and 35S terminator; Addgene #50269 and #50337; Engler et al., 2014) in a BsaI Golden Gate reaction to generate binary vectors containing the fragment-swapped Rcr3/Pip1 hybrids driven by the double 35S CaMV promoter and targeted to the apoplast using a NtPR1a signal peptide ...
-
bioRxiv - Molecular Biology 2024Quote: The plasmid pLVX-EF1alpha-SARS-CoV-2-orf6-2xStrep-IRES-Puro (Addgene plasmid #141387 from Nevan Krogan) [12] was used for the overexpression of the accessory proteins ORF6 ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmids for his-FUSLC (residue 1 to 163) and LAF-1 RGG (residue 1 to 168) were acquired from Addgene (https://www.addgene.org/127192/ (Fawzi laboratories ...
-
bioRxiv - Biochemistry 2021Quote: ... grown in a 100 mm plate format were co-transfected with 4.5 μg psPAX2 (Didier Trono lab, Addgene plasmid #12260), 500 ng pMD2.G (Didier Trono lab ...
-
bioRxiv - Neuroscience 2020Quote: ... a series of 6 - 10 microinjections (50 - 100 nL each, 200-300 μm depth) of AAV5.Flex.ArchT.tdTomato (Addgene, #28305-AAV5) were delivered along the posterior to anterior axis of RSC (2.0 to 4.0 mm posterior ...
-
bioRxiv - Immunology 2022Quote: ... 3×106 cells were harvested and added to 100 µl supplemented Nucleofector Solution V containing 0.7 µg CIBN-CAAX (Addgene #79574), 1.1 µg CRY2PHRmcherry2-RASAL3 ...
-
bioRxiv - Genetics 2023Quote: ... it was expanded and 100 million cells were infected with a BFP-expressing gRNA lentiviral library (Addgene Pooled Library #67988) at an infection rate of 25-30% to keep the Multiplicity of Infection (MOI ...
-
bioRxiv - Neuroscience 2024Quote: ... 60-100 nl AAV2-CAG-FLEX-GCaMP6f (Vigene, custom prepared) or AAV1-CAG-FLEX-GCaMP6f (Addgene, 100835-AAV1, 3x dilution) was delivered unilaterally into each of the following targeted brain regions ...
-
bioRxiv - Neuroscience 2019Quote: ... CaVα2δ-1 (Addgene, 26575), and enhanced green fluorescent protein cDNAs (eGFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO_HOXB13_#1 (Addgene #70093) and pLKO_HOXB13_#2 (Addgene #70094 ...
-
bioRxiv - Neuroscience 2023Quote: ... CaVα2δ-1 (Addgene, 26575) and eGFP (Clontech ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.3_SARS2_omicron BA.1 (Addgene plasmid #180375 ...
-
bioRxiv - Neuroscience 2020Quote: AAV1 of titer exceeding 1012vg/ml (Vector Biolabs, UNC Vector Core and Addgene) was used to package the plasmids ...
-
bioRxiv - Neuroscience 2019Quote: ... and AAV5-EF1α-DIO-EYFP (1.3 × 1013 vg/ml, Addgene, catalog #: 27056-AAV5).
-
bioRxiv - Neuroscience 2021Quote: ... 1E13 vector genomes (vg)/ml) and (AAV1-CAG-tdTomato-WPRE, ref Addgene-59462, 5E12 vector genomes (vg)/ml ...
-
bioRxiv - Physiology 2021Quote: ... 200nL AAV-hM3D(G)q-mCherry (Addgene 44361-AAV8, 4×1012 vg/mL) was injected bilaterally at 50nl/min and mice were allowed 2 weeks recovery prior to testing ...
-
bioRxiv - Physiology 2021Quote: ... 200 nL AAV-DIO-ChR2-mCherry (Addgene, 20297-AAV8, 1.9 × 101³ vg/ml) was injected unilaterally at 75 nL/min ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV9 pCAG-FLEX-tdTomato-WPRE (titer: 1.5×1012 viral genomes/mL; Addgene: 51503).
-
bioRxiv - Neuroscience 2022Quote: ... or AAV5.EF1⍺.DIO.eNpHR3.0.EYFP (Addgene; titre: 1.1×1013 genome copies per ml) was utilised for optogenetic experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV9.CaMKII 0.4.Cre (2.1 × 1013 GC/ml, 67 nl, Addgene #105558), 200 nl of which was pressure injected using a glass micropipette (outer tip diameter = 20–40 μm ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.1×10^13 g.c./mL AAV9-hSyn-DIO-hM4D(Gi)-mCherry from Addgene, 2.1×10^13 g.c./mL AAV9-hSyn-DIO-hM3D(Gq)-mCherry from Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... The cells were sparsely labeled by administration of AAVs (CamKII.Cre, 104vg/ml, Addgene # 105558-AAV9 and CAG.Flex.EGFP ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected AAV5-CAG-FLEX-ArchT-tdTomato (titer 10^13 gc/mL, Addgene) in the DLS ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV-synP-DIO-EGFP-WPRE-hGH (0.9×1013 GC/mL, Addgene,100043-AAV9). All viruses were aliquoted immediately on delivery and stored at −80 °C until use.
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus solution (1000 nl, titer ≥1013 vg/ml, #100836-AAV9 from Addgene) was injected in the SCN (ML +/-0.2 ...