Labshake search
Citations for Addgene :
851 - 900 of 10000+ citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... and pCas9_GFP plasmid (a gift from Kiran Musunuru; Addgene plasmid # 44719) (Ding et al ...
-
bioRxiv - Immunology 2023Quote: ... with the following plasmids: pCDNA3-HA-Akt1 (Addgene plasmid # 73408, RRID:Addgene_73408), pCDNA3-HA-Akt1-aa1-149 (Addgene plasmid # 73410 ...
-
bioRxiv - Immunology 2023Quote: ... with the following plasmids: pCDNA3-HA-Akt1 (Addgene plasmid # 73408, RRID:Addgene_73408), pCDNA3-HA-Akt1-aa1-149 (Addgene plasmid # 73410 ...
-
bioRxiv - Cell Biology 2023Quote: The 2nd generation lenti-viral packaging plasmid psPAX2 (Addgene plasmid #12260) was a gift from Didier Trono ...
-
bioRxiv - Cell Biology 2023Quote: ... and cloned into the Tet-on plasmid TLCV2 (Addgene plasmid #87360) digested with the same enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus was produced with the packaging plasmids psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Biochemistry 2023Quote: ... The sgRNA was cloned into the pX459 plasmid (Addgene plasmid #62988) and transfected into HeLa cells using JetPRIME (polyplus 114-07 ...
-
bioRxiv - Neuroscience 2024Quote: ... The plasmids pAdDeltaF6 (Addgene plasmid #112867; http://n2t.net/addgene:112867; RRID:Addgene_112867) and pAAV2/rh10 (Addgene plasmid # 112866 ...
-
bioRxiv - Plant Biology 2024Quote: ... The qRNA cassette was custom-synthesised by GenScript (www.genscript.com) and inserted into into SunTag dCas9 plasmid (Addgene Plasmid #117168) using the KpnI and MauBI restriction enzymes (Thermo Scientific™ ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a hNav1.5 plasmid (Addgene plasmid #145374; http://n2t.net/addgene:145374; RRID:Addgene_145374) was linearized with XbaI ...
-
bioRxiv - Biophysics 2023Quote: ... and pEVOL-pAzF plasmid (gift from Peter Schultz, Addgene plasmid # 31186) 59 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid pLX2 is a derivative of pMZ374 (Addgene plasmid ID: #59896)67 in which the Cas9 gene has been removed by EagI digestion ...
-
bioRxiv - Biophysics 2024Quote: ... with 1 [µg] of F-tractin GFP plasmid (Plasmid #58473 Addgene) and the P5 Primary Cell 4D-NucleofectorTM X Kit to then electroporate corresponding to the transfection program (CA-167 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the shCT or the pool of the two ZEB1 shRNA constructs were packaged into second generation virus particles using psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Neuroscience 2019Quote: ... or the shRNA control (dsRed2) AGTTCCAGTACGGCTCCAA or (GFP) CAAGCTGACCCTGAAGTTC were first cloned separately into a pSicoR vector (Addgene, Ref. 11579) under the control of a U6 promoter using HpaI and BstEII enzymes then ...
-
bioRxiv - Cancer Biology 2022Quote: ... were purchased from Horizon Discovery while the lentiviral vectors expressing scrambled shRNA (Sarbassov et al., 2005) and flag-tagged DPYD (Shaul et al., 2014) were bought from Addgene Inc ...
-
bioRxiv - Cancer Biology 2022Quote: We cloned shRNAs against SCD and GPX4 as well as control shRNA in the Tet-pLKO-puro vector (Gift from Dmitri Wiederschain, Addgene plasmid #21915 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK 293T derived amphotrophic phoenix cells were transfected by calcium phosphate method with 25μM chloroquine and the corresponding shRNA-targeting MLP vector in combination with psPax2 (Addgene, #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentivirus was produced by co-transfection of the TRIPZ shRNA with pMD2.G and psPAX2 (gifts from Didier Trono, Addgene plasmid #12259 and #12260 ...
-
bioRxiv - Neuroscience 2022Quote: ... the miR-30a-shRNA cassette was then amplified and inserted into pDIO-DSE-mCherry-PSE-MCS (gift from Beatriz Rico (Addgene plasmid #129669 ...
-
bioRxiv - Neuroscience 2023Quote: ... used for M1 knockdown was designed with the TRC algorithm (Broad Institute) and cloned into the pAAV-shRNA-ctrl vector from Addgene. pAAV-shRNA-ctrl was used as the empty vector plasmid in Figure 5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... non-eukaryotic gene targeting – target sequence: CAACAAGATGAAGAGCACCAA) or shRNA targeting MAT2A (MAT2Ash78 – target sequence: GTTCAGGTCTCTTATGCTATT; MAT2Ash85 – target sequence AGCAGTTGTGCCTGCGAAATA) in a pLL3.7 backbone (Addgene#11795) were packaged in HEK 293T cells as previously described [15] using Turbofect (Fisher ...
-
bioRxiv - Immunology 2019Quote: ... HEK293T cells were transfected with the respective sgRNA-containing plasmids together with the VSV-G (pCMV-VSV-G) envelope plasmid and dVPR (pCMV-dR8.2) packaging plasmids (from Addgene) using the XtremeGene9 transfection reagent (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... were co-transfected with pLenti plasmids and the packaging plasmids psPAX2 and pMD2G/VSV-G (Addgene Plasmids #12259-60) to produce lentiviral particles ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
bioRxiv - Molecular Biology 2020Quote: The RAD51 overexpression plasmid (pAB1118) was constructed by cloning RAD51 cDNA into the pCAGGS-mCherry plasmid (Addgene, plasmid #41583). First ...
-
bioRxiv - Neuroscience 2024Quote: Following plasmids were used for transfection pN1-CMV-sDarken (Addgene plasmid #184799, pN1-CMV-L-sDarken (Addgene plasmid #184800), null-mutant of sDarken (created in house) ...
-
bioRxiv - Genomics 2020Quote: ... The LES2A-CRE plasmid was assembled by replacing the XbaI-EcoRI fragment in the lentiCas9-Blast plasmid (Addgene plasmid #52962) (33 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Stable overexpression cells were created using Vangl1 and Vangl2 plasmids (Harvard PlasmID repository, HsCD00339551 and HsCD00294893) and Wnt5a plasmid that was a gift from Marian Waterman (Addgene plasmid # 35911 ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293T cells were transfected with the pLenti-VIM plasmid in combinations with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G (Addgene) using TransIT_293 transfection reagent (Mirus) ...
-
bioRxiv - Microbiology 2023Quote: HMGB1 plasmids for cell line construction were generated in a 2nd generation pLVX-M- puro transfer plasmid (Addgene plasmid# 125839). The HMGB1 sequence was obtained from the pcDNA3.1 Flag hHMGB1 plasmid (Addgene plasmid #31609).
-
bioRxiv - Bioengineering 2023Quote: ... Each well was transfected with 7.5 μg of one sgRNA plasmid of interest and 7.5 μg of a SpCas9 encoding plasmid (AddGene plasmid# 48137) through the calcium phosphate precipitation method as previously described (31) ...
-
bioRxiv - Genetics 2023Quote: ... and transfected with SNAP-DNMT3B plasmid in addition to HP1⍺-GFP plasmid (a gift from Tom Misteli, Addgene plasmid 17652). After 48 h cells were incubated for 30 min at 37 °C with SNAP-Cell 647-SiR substrate (NEB ...
-
bioRxiv - Immunology 2023Quote: ... LentiCRISPRv2–sgRNA Myc transfer plasmids was co-transfected with packaging plasmids psPAX2 and pMD2.G (Addgene plasmids #12259 and #12260) into HEK293T cells ...
-
bioRxiv - Immunology 2023Quote: ... HEK293T cells were transfected with sgRNA-or cDNA-encoding lentiviral vectors and packaging plasmids psPAX2 and pMD2.G (plasmid no. 12260 and plasmid no. 12259 from Addgene) using PEI (Sigma) ...
-
bioRxiv - Physiology 2024Quote: ... pLenti PGK Puro vectors expressing stable-HIF-11 (Plasmid #177202, addgene), pMD2.G (Plasmid #12259, addgene) and psPAX2 (Plasmid #12260, addgene) were ordered from Addgene.
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The plasmids pOSIP-TH (Addgene plasmid # 45978; http://n2t.net/addgene:4598; RRID:Addgene_45988) and pE-FLP (Addgene plasmid # 45978 ...
-
bioRxiv - Developmental Biology 2021Quote: ... To make the CAG::MAML-DN plasmid (Addgene plasmid # 160923, this study), an N-terminal MAML coding fragment (Weng et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... and the pMB80 plasmid (a gift from Tyler Jacks, Addgene plasmid # 12168) (McLaughlin et al ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid EGFP-α-SynA53T (Addgene plasmid #4082338; http://n2t.net/addgene:40823; RRID:Addgene_40823) was used for expression in SH-SY5Y cells (gift from David Rubinsztein).
-
bioRxiv - Evolutionary Biology 2020Quote: ... Packaging plasmid psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260), envelope plasmid pCL-VSV was a gift from Connie Cepko (Harvard Medical School)
-
bioRxiv - Evolutionary Biology 2021Quote: ... Guide RNAs were cloned into the pX459V2.0-HypaCas9 plasmid (AddGene plasmid #62988), or its custom derivative by replacing the puromycin resistance gene to blasticidin resistance gene ...
-
bioRxiv - Molecular Biology 2022Quote: ... the dCas9 plasmid was a gift from David Segal (Addgene plasmid # 100091) (O’Geen et al. ...
-
bioRxiv - Biophysics 2022Quote: The phage UbiC G3BP1-SNAP plasmid was purchased from Addgene (Plasmid #119949) and characterized and published previously (Wilbertz et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... and cloned into a pBID-Ubi plasmid (modified from Addgene Plasmid #35200) or were directly synthesized into the desired pBID-Ubi plasmid cloning site (Twist Bioscience ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids encoding Lck-mVenus (Addgene plasmid #84337; van Unen et al., 2016b) and the DORA-RhoA sensor (Unen et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 µg of the pX-EGFP-g1 expression plasmid (Addgene plasmid #107273)28 was transfected into 1.0 × 106 gene-targeted patient iPSCs ...
-
bioRxiv - Physiology 2019Quote: ... pAdtrack CMV plasmid was a gift from Bert Vogelstein (Addgene plasmid # 16405). SIRT1-mutE2 (T160/S161-A ...
-
bioRxiv - Biophysics 2019Quote: ... Cas9 mRNA was in vitro transcribed from pMLM3613 plasmid (Addgene Plasmid #42251) using mMessage mMachine T7 kit (Invitrogen ...