Labshake search
Citations for Addgene :
851 - 900 of 1190 citations for Ephrin type A receptor 4 EphA4 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: The expression plasmid for full-length human TRIM21 (HLTV-hTRIM21, referred to as TRIM21FL) was ordered from Addgene (#104973). Recombinant TRIM21FL was expressed and purified as described previously (Clift et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The human ACE2 coding sequence was amplified and inserted into the vector plasmid pLV-EF1α-IRES-Puro (#85132, Addgene) for transient expression in HEK293T cells to obtain virus containing the target gene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The human Brunello CRISPR knockout pooled sgRNA library was a gift from David Root and John Doench (Addgene #73178). sgRNA library lentivirus was produced via large-scale transfection of 20 × 150mm dishes of HEK293T/17 (12 × 106 cells/dish were plated and transfected with 30 µg plasmid DNA the following day) ...
-
bioRxiv - Neuroscience 2022Quote: ... a mammalian expression vector encoding an EGFP-human 0N4R tau fluorescent fusion protein was obtained from Addgene (catalog # 46904). This plasmid was developed by the lab of Karen Ashe [16] ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected either rAAV2/10 encoding ChrimsonR(K176R) and the red fluorophore tdTomato under control of the human synapsin promoter (1.13 × 1013 gc/ml; AddGene plasmid #59171 ...
-
bioRxiv - Neuroscience 2022Quote: ... and the cyan fluorophore mCerulean under control of the human synapsin promoter (1.5 × 1012 gc/ml; customized from AddGene plasmid #59171 ...
-
bioRxiv - Cell Biology 2023Quote: Human genome targeting CRISPR Knock-Out (GeCKO) v2 lentiviral pooled libraries (A and B libraries) were purchased from Addgene and amplified according to a published protocol (Sanjana et al. ...
-
bioRxiv - Microbiology 2023Quote: ... A no-template preparation (negative control) and a plasmid encoding egfp (positive control, pClneoEGFP human RASSF6b, Addgene plasmid #37021), along with non-transduced EBECs and HBECs were included ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentiviral constructs for HMGA2 overexpression were obtained by sub cloning human HMGA2 from pMXS-hs-HMGA2 (Addgene, no. 52727) into pCDH-EF1a-eFFly-mCherry replacing eFFly using restriction enzymes XbaI and BamHI-HF ...
-
bioRxiv - Biochemistry 2023Quote: Human Brunello genome-wide CRISPR KO pooled library (gift from David Root and John Doench, Addgene catalog no. 73178) was amplified by electroporation into Stbl4 electrocompetent cells (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... The reporter plasmids were subcloned using the vector backbone of pGL410_INS421 which has a human insulin promotor regulating firefly luciferase expression (a gift from Kevin Ferreri Addgene plasmid #49057 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids encoding the human UBF gene tagged with EGFP and nucleolin gene tagged with EGFP were obtained from Addgene (plasmids # 26672 and #28176 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was inserted into a pcDNA3.1-Hygro(-)-like with a C-terminal HRV 3C cut site and human Fc tag amplified from Addgene plasmid 145164 using standard cloning techniques ...
-
bioRxiv - Cell Biology 2023Quote: pEGFP-N1 human cofilin WT / S3A / S3E were a kind gift from James Bamburg (Addgene plasmid # 50859 / # 50860 / # 50861). Cofilin-1 ...
-
bioRxiv - Genetics 2023Quote: The rTetR(SE-G72P)-HDAC4-T2A-mTurquoise plasmid was generated by PCR amplifying full length human HDAC4 with appended gibson homology arms from pLB37_PB_pGK-H2B-mIFP-T2A-rTetR-HDAC4-zeo (Addgene #179440) using Q5 hot start polymerase (NEB M0494S) ...
-
bioRxiv - Genetics 2024Quote: Human pcDNA3-FLAG-RBBP5 plasmid used in the protein expression experiments was obtained from Addgene (Cat# 15550, MA, USA). Candidate variants were introduced using QuikChange II Site-directed mutagenesis kit according to manufacturer’s protocol (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726; http://n2t.net/addgene:59726; RRID: Addgene_59726) and targeted the first exon of the TBXT gene ...
-
bioRxiv - Genetics 2023Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722 ...
-
bioRxiv - Immunology 2024Quote: The human Calabrese CRISPR activation pooled library was a gift from David Root and John Doench (Addgene 92379, 92380). To subclone this pool we digested our protospacer-empty Libr.1-null transfer vector with BsmBI-v2 (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse vsv-plexin-B3 and human pECE-M2-BAIAP2 (IRSP53-Flag) were purchased from Addgene (#68038, #68039, #31656, USA).
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Developmental Biology 2024Quote: ... The TFAP2A gRNA targeted site of human TFAP2A construct (gift of Robert Tjian, Addgene #12100, (Williams and Tjian, 1991)) was mutated using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: cDNAs encoding human TSSK6 were obtained in pDONR223 (DNASU) and cloned into pLX302 or pLX304 (Addgene Plasmid #25896, #25890) using the Gateway Cloning system (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml) was a gift from Lin Tian (Addgene viral prep #111068-AAV5 ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Neuroscience 2020Quote: ... DIV 4 neurons were transfected with pGP-CMV-GCaMP6f (a gift from Douglas Kim, Addgene plasmid # 40755 ...
-
bioRxiv - Synthetic Biology 2019Quote: We modified the vector pX330A_dCas9–1 × 4 (a gift from Takashi Yamamoto, Addgene plasmid #63598) by inserting a gBlock Gene Fragment (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgFIGNL1#4: CCTATACCCAAGCAAGATGG) were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) in a single-step digestion-ligation reaction (2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: [4] DsRed from pBac-DsRed-ORCO_9kbProm-QF2 (a gift from Christopher Potter, Addgene ID #104877) (Riabinina et al. ...
-
bioRxiv - Cancer Biology 2023Quote: SUDHL-4 cell line was infected using pLKO.1-puro-GFP U6 sgRNA (Addgene #50920) containing BAX RNA guides or non-targeting RNA guide:
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Cancer Biology 2021Quote: Cas9-expressing stable cell lines were produced by infection with the lentivirus encoding human codon-optimized Streptococcus pyogenes Cas9 protein (LentiV_Cas9_puro, Addgene plasmid # 108100) and subsequent selection with 1 μg/mL puromycin ...
-
bioRxiv - Biochemistry 2022Quote: ... was made by ligating a PCR fragment encoding full-length human protein between ApaI and BamHI sites of pHis10-PS-SNAPf (75) (gift from Ron Vale; Addgene plasmid #78512 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vectors of the full-length SARS-CoV-2 spike and the human serine protease TMPRSS2 with a C-terminal C9-tag (TETSQVAPA) were acquired from AddGene (Summit Pharmaceutical International ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-CAGCGGAGCCCAGTAGATTC-3’ (exon19) (Raaijmakers et al., 2018) were cloned into the human codon optimised SpCas9 and chimeric guide expression plasmid (pX330, Addgene) using BbsI as previously described (Ran et al. ...
-
bioRxiv - Biophysics 2019Quote: Expression of N-terminally acetylated human αS and βS proteins was performed via co-expression with pNatB plasmid (Addgene #53613) in E ...
-
bioRxiv - Cell Biology 2020Quote: ... pLV-pEF1α-mNeonGreenPXN was generated by cloning of a sequence encoding human paxillin (PXN) from pmCherry Paxillin (a gift from Kenneth Yamada, Addgene plasmid #50526 ...
-
bioRxiv - Cell Biology 2021Quote: ... Source of different elements are as follows: LAMP1 signal peptide and human LAMP1 were PCR amplified from LAMP1-mGFP (Addgene Plasmid #34831 ...
-
bioRxiv - Biochemistry 2020Quote: ... and FMRP was purchased as a gene block from IDT. The human sequence (not optimized for E. coli) for FXR1P was purchased from Addgene. The genes coding for the human fragile X proteins (FMRP isoform 1 NCBI Reference Sequence ...
-
bioRxiv - Bioengineering 2020Quote: ... and mRuby2-tagged Lifeact were constructed by inserting the PCR-amplified cDNAs (human TAGLN2, pFN21ASDA0120, Kazusa DNA Research Institute; Lifeact, Addgene plasmid # 54688 ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Neuroscience 2021Quote: ... The GCaMP6s reporter was expressed in neurons under the human synapsin promoter following successful AAV transduction (AAV1-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA, AddGene). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: HEK-293T cells were transfected with the human PSD4 containing pLV lentivirus (VB160428-1095xdp – Vector Builder) together with the 3rd generation lentiviral packaging plasmid (Addgene): pMDLG/pRRE (Gag and Pol) ...
-
bioRxiv - Cancer Biology 2019Quote: Lentiviruses were prepared in human embryonic kidney 293T cells (ATCC) by triple transfection of the viral vector with psPAX2 + pMD.2G (Addgene) and transduced into MCF10A-5E ...
-
bioRxiv - Plant Biology 2020Quote: The human codon-optimized CAS9 with 2×35S CaMV promoter and Nos terminator was amplified from pAGM4723 plasmid (Addgene# 49772) using KpnI forward and PacI reverse primers (Supplemental Table 9) ...
-
bioRxiv - Neuroscience 2020Quote: ... P5-7 WT C57Bl/6 mice were used for the injection of AAV9 virus under human synapsin promoter (pAAV9.hSyn.iGluSnFR, commercially available from Addgene, USA) to drive transgenic expression of iGluSnFR in SGNs ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1 ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...