Labshake search
Citations for Addgene :
851 - 900 of 1981 citations for Cow Fibrinogen Like Protein 1 FGL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Neuroscience 2023Quote: ... DJ-1 (a gift from Mark Cookson, Addgene plasmid 29347), synapto-iATPSnFR2-miRFP670nano3 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg.Syn.jGCaMP7b.WPRE (Addgene, lot. no. v63074, titer 1 x 1013). For GCaMP expression in the DRG neurons ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Microbiology 2023Quote: pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV9-CaMKIIa-EGFP (titer: 1×10¹³ vg/mL, Addgene) for chemogenetic silencing and viral control ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-Syn-GCaMP6m-RPL10a (1−1013 gc/mL; Addgene #158777) was injected into PM ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV.1.hSyn.dio.EGFP (anterograde labelling, 140 nl, Addgene, no. 50457); AAV.9.hSy.chI.loxP.EGFP.loxP.SV40p(A ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Bioengineering 2022Quote: ... This plasmid was then used as a template for Golden Gate-based cloning (MoClo Plant Kit, Addgene) (47) ...
-
bioRxiv - Plant Biology 2024Quote: Designer TALEs were constructed using the Golden Gate TALEN and TALE Kit 2.0 (Addgene, Watertown, MA, USA) according to the manufacturer’s protocol79 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2-retro-CMV-bGlo-iCre-GFP (made in house; 1.07×1012 GC ml-1; 17) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; 4.6×1012 GC ml-1; 19); chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475 ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following ORF24 fragments: residues 1-201 (ORF24-NTD) (Addgene #138420), residues 1-271 (Addgene #138421) ...
-
bioRxiv - Cell Biology 2020Quote: ... The Toronto human knockout pooled library (TKO) Version 1 (Addgene #1000000069) was a gift from Jason Moffat19.
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: ... PX458 or PX458 containing gRNA and PLKO.1-puro (Addgene, #10878), were co-transfected into MEFs ...
-
bioRxiv - Biochemistry 2019Quote: The pLKO.1-puro empty vector was purchased from Addgene (#8453). A scrambled shRNA control and gene-specific shRNAs were designed through RNAi Central (http://cancan.cshl.edu/RNAi_central/step2.cgi) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-Ef1α-mCherry-IRES-Cre (Titer ≥ 7×1012 vg.mL−1, Addgene). Cholera Toxin Subunit B (Recombinant) ...
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... A pLKO.1-TRC vector (a gift from David Root; Addgene plasmid #10879 ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... or negative control annealed oligo was inserted into pLKO.1 (Addgene) (Stewart et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478 ...
-
bioRxiv - Neuroscience 2020Quote: ... and ligated into the pLKO.1 vector (Addgene, 8453 or 26655). Overexpression vectors of either lentiviral (N106 or N174 ...
-
bioRxiv - Systems Biology 2022Quote: pSIRV-AP-1-mCherry was a gift from Peter Steinberger (Addgene plasmid # 118095 ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... pCMV-p38-CA-EGFP and pCMV-eGFP-N1 (Addgene, 6085-1) by using standard Lipofectamine 3000 protocols (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... from Thermo Fisher at a 1:1.5 Lipo:DNA ratio for GFP-Cortactin (Addgene 50728), mEmerald-Talin (Addgene 54266 ...
-
bioRxiv - Cell Biology 2020Quote: Individual sgRNAs (Supplemental Table 1) were cloned into pLentiCRISPRv2 (Addgene #52961) at the BsmBI site as described by the depositor ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
bioRxiv - Neuroscience 2021Quote: were generated using pLKO.1 vector following instructions provided by Addgene. The shRNA sequence was selected using BLOCK-iT™ RNAi Designer provided by Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... SH2 domain sequences were obtained from Addgene (pGEX-SHP-1(NC)-SH2 ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of overnight culture containing pTXB1-Tn5 (Addgene plasmid #60240) was used to inoculate 1 L of ZYM-505 growth media containing 100 μg/mL ampicillin and 0.001% polypropylene glycol (L14699-AE ...
-
bioRxiv - Biochemistry 2022Quote: DNA constructs for the expression of KRAS4B (1-169) (Addgene #159539) and RAF1 (52-131 ...
-
bioRxiv - Neuroscience 2022Quote: ... for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene, plasmid #100834-AAV1) for calcium imaging were administered directly into the hippocampus ...
-
bioRxiv - Microbiology 2022Quote: ... HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid # 12263). The protease mutations D25N and R57G were generated by overlapping PCR using pCMV ΔR8.2 as a template ...
-
bioRxiv - Biophysics 2024Quote: ... with 1 [µg] of F-tractin GFP plasmid (Plasmid #58473 Addgene) and the P5 Primary Cell 4D-NucleofectorTM X Kit to then electroporate corresponding to the transfection program (CA-167 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNAs were cloned into pLentiCRISPR v2 Lko.1-puro (Addgene #52961) linearized with BsmBI ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subcloned into the lentiviral vector pLKO.1-puro (Addgene, USA). All plasmids used in this study were verified by DNA sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1 shGFP control was obtained from Addgene (cat#30323). Wildtype IDH1 with overexpression plasmid 3X HA tag was generated by Twist Bioscience (pTwist Lenti SFFV Puro) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-GFP (Addgene 51502-AAVrg, titer > 1 × 1013 pfu/ml) was used as control.
-
bioRxiv - Neuroscience 2023Quote: ... we used pKLO.1 containing a non-targeting sequence (Addgene #1864) (Sarbassov et al. ...
-
bioRxiv - Microbiology 2024Quote: ... pAR18 was constructed in three steps: 1) pTargetF (obtained from Addgene) was linearized with the primer pair AR430/431 while the cas9 sgRNA sequence was replaced by the sacB gene including its native promoter (amplified with AR432/433 from pEP17-KM [44]) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of AAV9.hsyn.FLEX.iGluSnFR.WPRE.SV40 (a gift from Loren Looger, Addgene plasmid # 98931 ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the OMS using TOMM20 (residues 1-55, from Addgene 66753).