Labshake search
Citations for Addgene :
851 - 900 of 1625 citations for Alpha 1 acid Glycoprotein AGP AAG since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... mice were injected in LHA with AAV5-hSyn-DIO-eGFP (1*10^12vc/ml; Addgene) and co-injected with rAAV5-ORXpr1-3TdTomato (1*10^12 gc/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... Scramble pLKO.1 shRNA control (further termed “scramble”) was a gift from David Sabatini (Addgene plasmid #1864 ...
-
bioRxiv - Neuroscience 2024Quote: ... and C1(1-29)-TurboID-V5_pCDNA3 vectors were obtained from Addgene (149414, 149415, 166971, 107173).58–60 Each was separately inserted into the pZac2.1 GfaABC1D-tdTomato vector109 obtained from Addgene (44332 ...
-
bioRxiv - Molecular Biology 2024Quote: Oligoes containing shRNA target sequences were cloned into pLKO.1-blast lentiviral vector (Addgene #26655). shRNA sequences used in this study are listed below.
-
bioRxiv - Neuroscience 2024Quote: ... DV - 3.8) with 200 nL AAV9.EF1a.dflox.hChR2(H134R).mCherry.WPRE.HGH (1×10^12 pp/mL, Addgene). For subjects in cohort 1 (n=2) ...
-
Sex-specific perturbations of neuronal development caused by mutations in the autism risk gene DDX3XbioRxiv - Neuroscience 2024Quote: ... and cells were then transduced with 1 µl of AAV8-Ef1a-mCherry-IRES-Cre (Addgene, #55632-AAV8 ...
-
bioRxiv - Biochemistry 2024Quote: ... The tag-free wildtype (Wuhan-hu-1) nucleocapsid protein plasmid was purchased from Addgene (#177937), and the plasmid encoding the Strep-tagged nucleocapsid protein was a kind gift from Dr ...
-
bioRxiv - Physiology 2024Quote: - pLenti CMV Puro DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17452 ...
-
bioRxiv - Cancer Biology 2024Quote: ... as template respectively and then cloned into plenti CMV Neo DEST (705-1) (Addgene, #17392) by In-Fusion HD Cloning Kits (TaKaRa ...
-
bioRxiv - Cancer Biology 2024Quote: shRNAs were cloned and inserted into the lentiviral vector pLKO.1 puro (Addgene Plasmid 10878) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... puromycin (Sigma-Aldrich, 1 μg/mL for three days; pLenti CMV Puro – Addgene plasmid #17452), blasticidin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... then transfecting with 1 µg equimolar packaging mix (pMDL, Addgene 1251; pRSV, Addgene1253; pVSV-g) and rtTA (phr_tet3g ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Neuroscience 2021Quote: ... Constructs injected included: AAV2/1-CAG-FLEx-jGCaMP8 constructs (pGP-AAV-CAG-FLEx-jGCaMP8f-WPRE, Addgene plasmid #162382 ...
-
bioRxiv - Molecular Biology 2020Quote: ... shRNA targeting the C/EBPα and ELF1 were cloned into pLKO.1 vector (Addgene, plasmid # 26655) harboring a blasticidin-selectable marker ...
-
bioRxiv - Genomics 2020Quote: ... the whole cDNA was subcloned into the lentiviral CMV GFP destination vector 736-1 (Addgene #19732), and further used along with packaging vectors to generate lentiviral particles (control lentiviral particles were generated in the same manner using empty lentiviral vectors) ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Neuroscience 2021Quote: ... and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL, Addgene, Catalog # 26969-AAV5).
-
bioRxiv - Cell Biology 2021Quote: ... pclbw-opa1(isoform 1)-myc (myc-Opa1) was a gift from David Chan (Addgene plasmid # 62845) 47 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected with the pLenti-PGK-Tacc3 or pLKO.1 TRC (control, Addgene 10879), pMD2G (Addgene 12259 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus (0.25-1 μl) containing either AAV5: hSyn-DIO-hM3Dq-mCherry (excitatory DREADD; Addgene, Watertown MA), AAV5 ...
-
bioRxiv - Immunology 2022Quote: ... and Bach2 ORF (Origene, MR224703 cloned into Addgene, Cat# 52107, 1 μg/ml, marked by GFP) using the X-tremeGENE transfection reagent (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... lentivirus destination vector or into the pLenti CMV Puro DEST (w118-1) vector (Addgene Plasmid #17452) using Gateway LR Clonase (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... RRL.sin.cPPT.SFFV/TMPRSS2(variant 1).IRES-neo.WPRE (MT130) was a gift from Caroline Goujon (Addgene plasmid # 145843). pGBW-m4137383 was a gift from Ginkgo Bioworks (Addgene plasmid #149541) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Annealed gRNA oligos were ligated to pLKO.1-puro U6 sgRNA BfuAI stuffer (Addgene plasmid # 50920) or to pLenti SpBsmBI sgRNA Hygro (Addgene plasmid # 62205) ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Molecular Biology 2020Quote: 1×106 cells of WTC p42 were transfected with 5mg AAVS1-TALEN R plasmid (Addgene #59026), 5 μg AAVS1-TALEN L plasmid (Addgene #59025) ...
-
bioRxiv - Genetics 2020Quote: ... digested pENTR-LUC (w158-1; a kind gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17473)(33 ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Molecular Biology 2020Quote: ... The pLenti CMV rtTA3 Blast (w756-1) was a gift from Eric Campeau (Addgene plasmid #26429).
-
bioRxiv - Cancer Biology 2020Quote: ... was cloned into pINDUCER20 (Meerbrey et al., 2011) and pLenti CMV Blast DEST (706-1) (Addgene plasmid #17451 was a gift from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Biochemistry 2021Quote: ... and ASW (Uniprot Q9BVC5-1) were subcloned into the UC Berkeley MacroLab 438B (Addgene plasmid #55219), 438Rgfp (Addgene plasmid #55221) ...
-
bioRxiv - Biochemistry 2021Quote: ... and ASW (Uniprot Q9BVC5-1) were subcloned into the UC Berkeley MacroLab 438A (Addgene plasmid #55218) plasmid along with sequences encoding N-terminal affinity/fluorescence tags ...
-
bioRxiv - Microbiology 2020Quote: ... pLenti CMV Blast DEST (706-1) (a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17451)) constructs carrying a human Plxdc1-TwinStrep or Plxdc2-TwinStrep expression cassette (pLenti-CMV-Blast-Plxdc1-Strep/ pLenti-CMV-Blast-Plxdc2-Strep ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2012) were cloned into the pLKO.1-Puro vector (a gift from R. Weinberg; Addgene #8453) to generate pLKO.1-Cys-TD and pLKO.1-Scr-TD ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... Major changes to the reported protocol included: 1) Use of a 2nd generation psPAX2 (Addgene, #12260) lentivirus packaging system instead of the 3rd generation system used by the Bloom lab ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were infused with diluted (1:5) or undiluted virus pAAV5-CAMKIIa-(hChR2- H134R)-eYFP (Addgene-ChR2 titre ...
-
bioRxiv - Cell Biology 2022Quote: ... The GFP-RIAM(1-666) construct was a gift from Chinten James Lim (Addgene plasmid 80028) (Lee et al. ...
-
bioRxiv - Genetics 2022Quote: ... Transfection mix for each shRNA contained 8.75μg of shRNA targeting construct in pLKO.1 (Addgene#8453), 8.75μg psPAX2 (Addgene#12260 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5; http://www.addgene.org/100835/; RRID:Addgene_100835) was a gift of Douglas Kim and GENIE Project ...
-
bioRxiv - Neuroscience 2022Quote: ... adeno-associated virus AAV8 carrying CaMKII-GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40. Addgene. #100834. 1×1012 genome copies per ml) was injected with Nanoject-III (Drummond Scientific Company ...
-
bioRxiv - Molecular Biology 2022Quote: ... was used per manufacturer’s instruction to add 1 µg of the mRFP-UtrCH plasmid (Addgene #26739) to both WT and PDKO T-REx-293 cells seeded in 6-well plates at ∼70% confluency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Annealed gRNA oligos were ligated to pLKO.1-puro U6 sgRNA BfuAI stuffer (Addgene plasmid #50920), and lentiviral particles were generated ...
-
bioRxiv - Cell Biology 2024Quote: ... F-tractin and Linker 1 were derived from pEGFP-C1 F-tractin-EGFP (Addgene Plasmid #5847)48 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...