Labshake search
Citations for Addgene :
851 - 900 of 1961 citations for 7 Hydroxy 4 methoxy 1 indanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Individual sgRNAs (Supplemental Table 1) were cloned into pLentiCRISPRv2 (Addgene #52961) at the BsmBI site as described by the depositor ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
bioRxiv - Neuroscience 2021Quote: were generated using pLKO.1 vector following instructions provided by Addgene. The shRNA sequence was selected using BLOCK-iT™ RNAi Designer provided by Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... SH2 domain sequences were obtained from Addgene (pGEX-SHP-1(NC)-SH2 ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the OMS using TOMM20 (residues 1-55, from Addgene 66753).
-
bioRxiv - Cancer Biology 2023Quote: ... plasmids as described previously.11 pLKO.1-Scrambled plasmids (Addgene, #136035) were used as negative control ...
-
bioRxiv - Physiology 2023Quote: ... pLKO.1-Puro-scramble shRNA (1864) plasmids were obtained from Addgene. The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354 ...
-
bioRxiv - Cell Biology 2023Quote: SH-SY5Y cells stably overexpressing LAMP-1-Flag-RFP (Addgene; #102931) and stained with CellMask Green (1/1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Level 1 plasmids pL1P1OsActinP:hpt-int:35sT selection cassette (Addgene #165423), pL1P2OsUbiP:Cas9:NosT (Addgene #165424) ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNAs were cloned into pLentiCRISPR v2 Lko.1-puro (Addgene #52961) linearized with BsmBI ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subcloned into the lentiviral vector pLKO.1-puro (Addgene, USA). All plasmids used in this study were verified by DNA sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1 shGFP control was obtained from Addgene (cat#30323). Wildtype IDH1 with overexpression plasmid 3X HA tag was generated by Twist Bioscience (pTwist Lenti SFFV Puro) ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pKLO.1 containing a non-targeting sequence (Addgene #1864) (Sarbassov et al. ...
-
bioRxiv - Microbiology 2024Quote: ... pAR18 was constructed in three steps: 1) pTargetF (obtained from Addgene) was linearized with the primer pair AR430/431 while the cas9 sgRNA sequence was replaced by the sacB gene including its native promoter (amplified with AR432/433 from pEP17-KM [44]) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of AAV9.hsyn.FLEX.iGluSnFR.WPRE.SV40 (a gift from Loren Looger, Addgene plasmid # 98931 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg.Syn.jGCaMP7b.WPRE (Addgene, lot. no. v63074, titer 1 x x 1013). For sparse expression of GCaMP in the brainstem neurons ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.3_SARS2_omicron BA.1 (Addgene plasmid #180375; http://n2t.net/addgene: 180375; RRID:Addgene_180375) and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
bioRxiv - Neuroscience 2023Quote: ... and one of the following helper plasmids: pAAV2/1 (Addgene #112862), pAAV2/2 (Addgene #104963) ...
-
bioRxiv - Biophysics 2023Quote: ... a pCDFDuet-1 plasmid containing His6-PPX-nsp7/8 (Addgene: 159092) was transformed into E ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the pLKO.1 lentiviral vector system (Addgene, Cambridge, MA, USA). A list of the stable cell lines generated is summarized in supplementary table S1.
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-nEF-Con/Foff-ChRmine-oScarlet (Addgene 137161, 1×1013 titer) was bilaterally injected into either LH (AP ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of overnight culture containing pTXB1-Tn5 (Addgene plasmid #60240) was used to inoculate 1 L of ZYM-505 growth media containing 100 μg/mL ampicillin and 0.001% polypropylene glycol (L14699-AE ...
-
bioRxiv - Biochemistry 2022Quote: DNA constructs for the expression of KRAS4B (1-169) (Addgene #159539) and RAF1 (52-131 ...
-
bioRxiv - Neuroscience 2022Quote: ... for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene, plasmid #100834-AAV1) for calcium imaging were administered directly into the hippocampus ...
-
bioRxiv - Microbiology 2022Quote: ... HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid # 12263). The protease mutations D25N and R57G were generated by overlapping PCR using pCMV ΔR8.2 as a template ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2retro-syn-jGCaMP7f-WPRE (Addgene 104488, 1 × 1013 GC/ml) [1:1 mixture] ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Neuroscience 2022Quote: ... and 100-200 nl cre-dependent tdTomato (AAV2/1.FLEX.tdTomato.WPRE.SV40, Addgene), and some cases ...
-
bioRxiv - Cell Biology 2023Quote: ... Wild type Keratin 8 was cloned into pGEX-6p-1 (Addgene) (WT-K8-GST ...
-
bioRxiv - Cell Biology 2023Quote: ... The Level 1 plasmids pL1P1OsActinP:hpt-int:35sT selection cassette (Addgene #165423), pL1P2OsUbiP:Cas9:NosT (Addgene #165424 ...
-
bioRxiv - Neuroscience 2023Quote: ... These genomes were packaged in serotype 1 AAV capsids by Addgene (catalog numbers 52473-AAV1 ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product was further cloned into pGEX-4T-1 (Addgene) in-frame with the N-terminal GST-tagged fusion construct(21) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PGC-1α cDNA from pcDNA4 myc PGC-1 alpha (Addgene #10974) was cloned into the FUBW backbone driven by a ubiquitin promoter ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1000 ng frame selector (pCAS9-mCherry-Frame +0/+1/+2, Addgene plasmid #66939/#66940/#66941 ...
-
bioRxiv - Microbiology 2024Quote: HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid #12263). The pCAGGS HIV-1JRFL gp160 expression plasmid was kindly provided by Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... AAV-PHP.S-tdTomato (Addgene, 59462- PHP.S, titer ≥ 1×10¹³ vg/mL) was utilized ...
-
bioRxiv - Cancer Biology 2024Quote: The shRNA sequences were inserted into the pLKO.TRC.1 plasmid (Addgene, Cat#10878 ...
-
bioRxiv - Molecular Biology 2024Quote: ... into a vector derived from the pLKO.1 vector (Addgene #10878) with pre-crRNAs under control of the hU6 promoter and BFP under control of the EF-1α promoter.
-
bioRxiv - Immunology 2024Quote: E2F-1 wt-pGex2TK was a gift from William Kaelin (Addgene plasmid # 21668 ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides for shRNAs were cloned into pLKO.1 vector (Addgene, #21297). The day before transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... The target sequences were inserted into a pLKO.1 vector (Addgene). As a negative control an shRNA containing a scramble sequence (ACAAGATGAAGAGCACCA ...
-
bioRxiv - Biophysics 2024Quote: ... the pLKO.1 puro (Addgene; 8453; a gift from Bob Weinberg) backbone was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-M-2×Strep-IRES-Puro(Addgene#141386, Wuhan-Hu-1) with NotI/BamHI- ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-E-2×Strep-IRES-Puro (Addgene#141385, Wuhan-Hu-1), pLVX-M-2×Strep-IRES-Puro(Addgene#141386 ...
-
bioRxiv - Molecular Biology 2024Quote: ... R-5’ CAGACGCGTTTAGCCCTCCCACACATAACCAGA 3’ from pLKO.1-Blasticidin vector (Addgene #26655), and ligated after AgeI and MluI digestion and gel purification with the vector backbones ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2-retro-EF1a-Cre (Addgene #55636, 1 × 1013 genomic copies (gc)/mL ...